ID: 1071612848

View in Genome Browser
Species Human (GRCh38)
Location 10:87047326-87047348
Sequence ACTCAGAAGGCTGAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96754
Summary {0: 392, 1: 5972, 2: 13874, 3: 31033, 4: 45483}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071612848_1071612858 17 Left 1071612848 10:87047326-87047348 CCTCCTGCCTCAGCCTTCTGAGT 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data
1071612848_1071612856 11 Left 1071612848 10:87047326-87047348 CCTCCTGCCTCAGCCTTCTGAGT 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
Right 1071612856 10:87047360-87047382 TAGGCCTATACTACCACAACTGG No data
1071612848_1071612854 -8 Left 1071612848 10:87047326-87047348 CCTCCTGCCTCAGCCTTCTGAGT 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
Right 1071612854 10:87047341-87047363 TTCTGAGTAGCTGGGACCATAGG 0: 33
1: 885
2: 12123
3: 73583
4: 195787

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071612848 Original CRISPR ACTCAGAAGGCTGAGGCAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr