ID: 1071612849

View in Genome Browser
Species Human (GRCh38)
Location 10:87047329-87047351
Sequence GCTACTCAGAAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 627049
Summary {0: 2887, 1: 85071, 2: 182808, 3: 212496, 4: 143787}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071612849_1071612856 8 Left 1071612849 10:87047329-87047351 CCTGCCTCAGCCTTCTGAGTAGC 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787
Right 1071612856 10:87047360-87047382 TAGGCCTATACTACCACAACTGG No data
1071612849_1071612858 14 Left 1071612849 10:87047329-87047351 CCTGCCTCAGCCTTCTGAGTAGC 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071612849 Original CRISPR GCTACTCAGAAGGCTGAGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr