ID: 1071612851

View in Genome Browser
Species Human (GRCh38)
Location 10:87047333-87047355
Sequence CCCAGCTACTCAGAAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701865
Summary {0: 3774, 1: 101495, 2: 206159, 3: 237850, 4: 152587}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071612851_1071612858 10 Left 1071612851 10:87047333-87047355 CCTCAGCCTTCTGAGTAGCTGGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data
1071612851_1071612856 4 Left 1071612851 10:87047333-87047355 CCTCAGCCTTCTGAGTAGCTGGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587
Right 1071612856 10:87047360-87047382 TAGGCCTATACTACCACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071612851 Original CRISPR CCCAGCTACTCAGAAGGCTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr