ID: 1071612853

View in Genome Browser
Species Human (GRCh38)
Location 10:87047339-87047361
Sequence TATGGTCCCAGCTACTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282078
Summary {0: 26, 1: 838, 2: 12094, 3: 73277, 4: 195843}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071612853_1071612858 4 Left 1071612853 10:87047339-87047361 CCTTCTGAGTAGCTGGGACCATA 0: 26
1: 838
2: 12094
3: 73277
4: 195843
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data
1071612853_1071612856 -2 Left 1071612853 10:87047339-87047361 CCTTCTGAGTAGCTGGGACCATA 0: 26
1: 838
2: 12094
3: 73277
4: 195843
Right 1071612856 10:87047360-87047382 TAGGCCTATACTACCACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071612853 Original CRISPR TATGGTCCCAGCTACTCAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr