ID: 1071612858

View in Genome Browser
Species Human (GRCh38)
Location 10:87047366-87047388
Sequence TATACTACCACAACTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071612851_1071612858 10 Left 1071612851 10:87047333-87047355 CCTCAGCCTTCTGAGTAGCTGGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data
1071612853_1071612858 4 Left 1071612853 10:87047339-87047361 CCTTCTGAGTAGCTGGGACCATA 0: 26
1: 838
2: 12094
3: 73277
4: 195843
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data
1071612849_1071612858 14 Left 1071612849 10:87047329-87047351 CCTGCCTCAGCCTTCTGAGTAGC 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data
1071612848_1071612858 17 Left 1071612848 10:87047326-87047348 CCTCCTGCCTCAGCCTTCTGAGT 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
Right 1071612858 10:87047366-87047388 TATACTACCACAACTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071612858 Original CRISPR TATACTACCACAACTGGCTG TGG Intergenic
No off target data available for this crispr