ID: 1071615183

View in Genome Browser
Species Human (GRCh38)
Location 10:87069007-87069029
Sequence ATATAAGTTACCCTTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071615183_1071615184 -6 Left 1071615183 10:87069007-87069029 CCATTAAAAAGGGTAACTTATAT 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1071615184 10:87069024-87069046 TTATATCCATGTAAATTACTTGG No data
1071615183_1071615186 17 Left 1071615183 10:87069007-87069029 CCATTAAAAAGGGTAACTTATAT 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1071615186 10:87069047-87069069 AATTATCATGAACATACATATGG No data
1071615183_1071615187 24 Left 1071615183 10:87069007-87069029 CCATTAAAAAGGGTAACTTATAT 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG No data
1071615183_1071615188 28 Left 1071615183 10:87069007-87069029 CCATTAAAAAGGGTAACTTATAT 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1071615188 10:87069058-87069080 ACATACATATGGAAAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071615183 Original CRISPR ATATAAGTTACCCTTTTTAA TGG (reversed) Intronic
901113958 1:6825213-6825235 AGATAAGTTTCTTTTTTTAAGGG + Intronic
902390948 1:16105895-16105917 TTATCTGTTAACCTTTTTAAAGG + Intergenic
906393414 1:45439491-45439513 AAATAATTCACCCTATTTAAGGG - Intronic
907355923 1:53873832-53873854 ATATTAATTAACTTTTTTAAAGG + Intronic
907567565 1:55450190-55450212 AGTTAAGTTACAGTTTTTAAAGG + Intergenic
908557429 1:65270551-65270573 GTATAAATTACCCTCTTTAAAGG + Intronic
910420857 1:87061263-87061285 ACATAAGTTAGCCATTTTACAGG + Intronic
911897942 1:103462850-103462872 AAATAGGTTTCCATTTTTAATGG - Intergenic
913032617 1:114924931-114924953 AAATAAGGTACCATTTTAAAGGG + Intronic
913441068 1:118898303-118898325 ATTTAACTTACCCTTTTCAGGGG - Intronic
914453567 1:147814888-147814910 GTAGAAGTTACCCTTTTGTAAGG + Intergenic
915192661 1:154164798-154164820 ATTTATGTTACCATTTTTGATGG - Intronic
916709160 1:167386999-167387021 ATATACTTTGCCCTTTTAAATGG + Intronic
916711829 1:167417577-167417599 ATCTAAGTTCCCCTTCTTATTGG + Exonic
916970986 1:170015930-170015952 ATAAAAAATACCCTTTTTAGAGG + Intronic
917922591 1:179763272-179763294 GTAGAAGTTACCCTTTTGTAAGG - Intronic
917948906 1:180008038-180008060 ATATAAGTTAACCAGATTAAAGG + Intronic
918033405 1:180840294-180840316 ATATAAATTTCCATTTCTAAAGG - Intronic
918888872 1:190237025-190237047 ATATAAGAGACTCTTTGTAATGG - Intronic
919246074 1:194986150-194986172 ATCTAAATTACCATTTTTAAAGG - Intergenic
919556358 1:199058830-199058852 TTACAAGGTACCCTTTATAAAGG - Intergenic
919663794 1:200273088-200273110 ACATAAGTTACCCTGTGTATGGG - Intergenic
919840792 1:201608068-201608090 ATAAGAACTACCCTTTTTAAAGG + Intergenic
921332553 1:214054018-214054040 AGATAAGGTAACTTTTTTAATGG + Intergenic
922867563 1:228873190-228873212 ATATAAGTAACCCTTGGGAAAGG + Intergenic
1063356444 10:5403340-5403362 ATTTAAGTTAACATTTTAAAAGG + Intronic
1064141127 10:12791303-12791325 ACAAAATTTACCATTTTTAAGGG + Intronic
1064534879 10:16348622-16348644 TTTTAACTTACCTTTTTTAAAGG - Intergenic
1065009322 10:21407333-21407355 GTAGAAGTTACCCTTTTGTAAGG + Intergenic
1065663124 10:28026740-28026762 TTATAAGTTACCCAGTTTATAGG + Intergenic
1067496549 10:46765773-46765795 GCATATGTTATCCTTTTTAATGG - Intergenic
1067598106 10:47574629-47574651 GCATATGTTATCCTTTTTAATGG + Intergenic
1067914027 10:50376924-50376946 ATATGAGTAACCTTTTTTCATGG - Intronic
1068076562 10:52263435-52263457 ATAAAACTTTCCCATTTTAAGGG + Intronic
1068158478 10:53232602-53232624 TTATCATTTTCCCTTTTTAATGG - Intergenic
1068290025 10:54989652-54989674 AAATAAATTACCCATTTCAATGG - Intronic
1068323888 10:55458175-55458197 ATATAAGATAAACTTTTAAATGG + Intronic
1069173830 10:65265076-65265098 ATAAAATTTATCATTTTTAAGGG - Intergenic
1069460713 10:68592394-68592416 ATATAAGTTACCTTTTCAAGGGG - Intronic
1070410984 10:76140196-76140218 ATAAAAGTTACCCTGTTAAAAGG + Intronic
1071037856 10:81268778-81268800 CTCAAAGTTGCCCTTTTTAATGG - Intergenic
1071615183 10:87069007-87069029 ATATAAGTTACCCTTTTTAATGG - Intronic
1071699721 10:87917354-87917376 ATATAAAATACCATTTTTGAAGG - Intronic
1071760825 10:88604364-88604386 ATATAGTTTACACTTTTAAAAGG + Intronic
1072507324 10:96081561-96081583 ATAAAAGTTTGCCTCTTTAAGGG + Intergenic
1077260795 11:1618905-1618927 CTAAAAGGAACCCTTTTTAAGGG - Intergenic
1077704077 11:4467431-4467453 TTATAAGTTACCCAATTTAATGG + Intergenic
1077847759 11:6044063-6044085 ATATAAGCTTCCCTTTTTTATGG - Intergenic
1078857497 11:15218582-15218604 ATATATATTTCCCTTTTGAAGGG + Intronic
1079219505 11:18547625-18547647 ATATAAATTACAATTTTTAAAGG + Intronic
1080159246 11:29153113-29153135 ATAAAACTTACTCTTTTAAATGG + Intergenic
1080318640 11:30979948-30979970 ATATAAATGACCCTTTTGAGAGG - Intronic
1081644867 11:44783148-44783170 ATATAATTTGTCCTTTTTAAAGG + Intronic
1081699326 11:45142892-45142914 AAAGATGTTCCCCTTTTTAATGG - Intronic
1082246268 11:49926840-49926862 ATAGTAATTAGCCTTTTTAAGGG + Intergenic
1082296059 11:50442185-50442207 GTTTAGGTTATCCTTTTTAATGG + Intergenic
1088102405 11:106169774-106169796 ATTTTAGTTACCATTTTTAGTGG + Intergenic
1088122897 11:106390531-106390553 ATAGATGTTACCCTTTTGTAAGG + Intergenic
1089370708 11:117954220-117954242 ATATACGGTACCTTATTTAATGG - Intergenic
1090126849 11:124095092-124095114 ATATAATTTATGCTATTTAATGG - Intergenic
1090491466 11:127164900-127164922 GTCAAAGTTACCCATTTTAAAGG - Intergenic
1091053303 11:132394701-132394723 ATATAAGTTTGCCTTTATTAAGG + Intergenic
1093133595 12:15421714-15421736 ATATCATTTACCATTATTAAAGG + Intronic
1093444511 12:19241242-19241264 AGATAATTTATCCTTTTAAAGGG + Intronic
1093739346 12:22663921-22663943 ATAGAAATTACTCTTTTAAACGG - Intronic
1095445829 12:42281217-42281239 ATATCACTTATACTTTTTAAAGG + Intronic
1097719806 12:63008339-63008361 ATATAAATTTCCCTTATGAAAGG - Intergenic
1098397791 12:70040590-70040612 ATATAATTTACTCTATTAAATGG + Intergenic
1098685562 12:73415604-73415626 ATATAATTTACCTTTTAAAAAGG + Intergenic
1099098206 12:78402371-78402393 ATATAGGCCACCCTTTTGAAAGG + Intergenic
1099168569 12:79337175-79337197 ATATTATTTATCCATTTTAATGG + Intronic
1099320960 12:81148155-81148177 ATATAAGTTTTTTTTTTTAATGG - Intronic
1099946409 12:89249736-89249758 ATATAAAATCCTCTTTTTAAAGG + Intergenic
1100828429 12:98496198-98496220 GTAAAATTTACTCTTTTTAAGGG - Intronic
1101500845 12:105302281-105302303 GTTTAGGTTATCCTTTTTAATGG + Intronic
1105597713 13:21855156-21855178 AAATAAGTAACATTTTTTAAAGG + Intergenic
1106854664 13:33837108-33837130 ATAAAATATACCCATTTTAAGGG + Exonic
1108254483 13:48597271-48597293 GTAGAAGTTACCCTTTTGTAAGG + Intergenic
1109666444 13:65545196-65545218 AAATAAGTTAAGCTTTTAAAAGG - Intergenic
1110186576 13:72681961-72681983 ATATAATTTAGAATTTTTAAGGG - Intergenic
1111285037 13:86079525-86079547 ATATAAATTAATGTTTTTAAAGG - Intergenic
1111850252 13:93564196-93564218 ATAAAGGTTACTCTTTTTTAAGG - Intronic
1112120626 13:96406954-96406976 ATATAATTTAATGTTTTTAATGG + Intronic
1112604971 13:100895474-100895496 AAATAAGATAGACTTTTTAAAGG - Intergenic
1115176225 14:30564105-30564127 ATAAAAGTCACCCATTTTAGGGG + Intronic
1115859798 14:37671540-37671562 ATATTAGTTAACATTTTGAACGG + Intronic
1116387028 14:44344329-44344351 AAATAAGTTTCTCTTTTAAATGG + Intergenic
1116502798 14:45640560-45640582 AGAGAAGTTACCCTTTTGAAGGG - Intergenic
1116824727 14:49661317-49661339 ATATCAGTTACCATATCTAAGGG - Intronic
1117303201 14:54448371-54448393 ATAATATTTACCCATTTTAAGGG + Intergenic
1117499075 14:56333939-56333961 ATTTAAATTGCCATTTTTAATGG - Intergenic
1118417430 14:65557076-65557098 ATATATGTTAACCTTATTTAAGG + Intronic
1120518742 14:85501271-85501293 ATATAAGCCTCCCTTTCTAAAGG + Intergenic
1121390539 14:93569746-93569768 ATTTAAGTTCTCCTTCTTAAGGG + Intronic
1123912217 15:24978948-24978970 ATAGAAGTTACTCTTTTTCTTGG + Intergenic
1124088488 15:26574858-26574880 ATACAATTTACCCATTTAAAGGG - Intronic
1124601259 15:31134417-31134439 ATAGAAGTTACCCTTTTGCAAGG + Intronic
1125976441 15:43956994-43957016 AGTTAAGTCAGCCTTTTTAAAGG + Intronic
1126492609 15:49255701-49255723 ATATGAATTCCCCTTTATAAAGG + Intronic
1126949901 15:53869423-53869445 GTATGAATTACCCTTTTTATTGG - Intergenic
1127233347 15:57020426-57020448 AAATAAAGTACCCTTTTAAAAGG - Intronic
1127324907 15:57885553-57885575 ATCTAAAGTACACTTTTTAAGGG - Intergenic
1127375112 15:58377072-58377094 GTAGAAGTTACCCTTTTGTAAGG - Intronic
1128958509 15:71974773-71974795 ATGTAATTTACCCTATCTAAAGG + Intronic
1130803956 15:87298880-87298902 ATATAAGTGACCATTTTCAATGG - Intergenic
1131760165 15:95613834-95613856 ACAAAAGTTATGCTTTTTAAAGG - Intergenic
1134770293 16:16802890-16802912 ATAAAAGTTACTCTTTAGAAGGG - Intergenic
1137515613 16:49140863-49140885 TTATAAGTTACCCAGTGTAAAGG + Intergenic
1138755318 16:59477097-59477119 ATGTAAGTCACCCTTTTGAATGG - Intergenic
1139743812 16:69058324-69058346 ATATAACTAATCCTGTTTAAGGG + Intronic
1139838127 16:69856421-69856443 GTAAAATTTACCCTTTCTAAGGG - Intronic
1140186284 16:72775237-72775259 ATATAACTTATCTATTTTAAAGG + Intergenic
1140966330 16:79969650-79969672 ATATTAGTCTCCCATTTTAAAGG - Intergenic
1141702154 16:85647415-85647437 ATATAATTCACCATCTTTAAGGG - Intronic
1142931529 17:3288985-3289007 ATCTATCTTACCCATTTTAAAGG - Intergenic
1144010642 17:11145504-11145526 ATAAAAGTTACCATGATTAATGG - Intergenic
1144762136 17:17713114-17713136 ATAAAATTCACCCTTTTAAAGGG - Intronic
1145717808 17:27039363-27039385 GTCTAAGATACCCTTTTTCAAGG - Intergenic
1145801821 17:27691904-27691926 CTTTAAGTTATCCTTTTTAATGG - Intergenic
1146294104 17:31634950-31634972 ATATCTGTTAACCATTTTAAAGG - Intergenic
1146734816 17:35229565-35229587 ATATAAGTAGCCTTTATTAAAGG + Intergenic
1146753611 17:35406153-35406175 ATTTAAAATAACCTTTTTAAAGG - Intergenic
1148527997 17:48361144-48361166 ATAAAATTTACCCATTTAAAAGG - Intronic
1149155216 17:53621373-53621395 AAATAAATTACCATGTTTAAAGG + Intergenic
1149476866 17:56969095-56969117 AAATTAGTTACCCTTTACAAAGG - Intergenic
1149483664 17:57024037-57024059 CTACTAGTTGCCCTTTTTAATGG + Intergenic
1149816386 17:59728832-59728854 ATATAATTCACCCATTTAAACGG + Intronic
1150653585 17:67025274-67025296 ATAAAAGTAACCCTTTTGAAGGG - Intronic
1152508550 17:80770002-80770024 TTATAAATTACCCTGTTTCAGGG - Intronic
1153206128 18:2703764-2703786 ATAAAATTTACACTTTTTAAGGG + Exonic
1156871513 18:41951271-41951293 ATATAAATTACCTTTTTGAATGG + Intergenic
1157234245 18:45948297-45948319 ATATAAGCAACCATTTTTATGGG - Intronic
1157885945 18:51366456-51366478 ATATAAGACACCCTTCTTCAAGG + Intergenic
1158380307 18:56922430-56922452 ATGTGTGTTACCTTTTTTAAAGG + Intronic
1167063346 19:47165524-47165546 ATGTAAGTTACCTGTTTTCAGGG + Intronic
1168621734 19:57884716-57884738 ATATAAATAAGCCATTTTAATGG - Intronic
925195071 2:1916265-1916287 CTCAAAGTTACCCATTTTAATGG + Intronic
925832996 2:7914595-7914617 TTATACGTTATCATTTTTAATGG - Intergenic
925941971 2:8829282-8829304 ATAACATTCACCCTTTTTAATGG - Intronic
926472204 2:13274578-13274600 ATCTTAGTTACCAGTTTTAAAGG + Intergenic
926804412 2:16692677-16692699 ATGTATGTTAGCCTTTTTTAGGG - Intergenic
926977252 2:18527122-18527144 AAAAAAGTTACACTTTCTAATGG - Intergenic
927433157 2:23043981-23044003 ATATAAGGTAACATTGTTAAAGG - Intergenic
929266366 2:39923058-39923080 AAACAAGTTAAACTTTTTAAAGG + Intergenic
929485917 2:42354215-42354237 ATACAAGTTGCCCATTTAAAGGG - Intronic
930081378 2:47451720-47451742 ATATAAATTTCCCTTTGTGAAGG - Intronic
930113587 2:47699687-47699709 GTAGAAGTTACCCTTTTGTAAGG - Intronic
931017024 2:57994046-57994068 ATAAAGGCTCCCCTTTTTAAAGG + Intronic
931157291 2:59649677-59649699 ATAAAAAATACCCTTTTCAATGG - Intergenic
931599886 2:63992473-63992495 GTTTAGGTTATCCTTTTTAATGG + Intronic
932005631 2:67924312-67924334 GTAGAAGTTACCCTTTTGTAAGG - Intergenic
932120851 2:69098672-69098694 ATAAAAATCACCCTTTTAAAAGG + Intronic
936001778 2:108838865-108838887 ATCTAGGTTATCATTTTTAATGG + Intronic
937724160 2:125140393-125140415 ATATAAGCTTTCATTTTTAATGG - Intergenic
938002972 2:127760379-127760401 ATATCAGTTGCCCTTTATTAAGG - Intronic
938794798 2:134708416-134708438 ACATATCTTACCATTTTTAAGGG + Intronic
939103745 2:137925577-137925599 TTATAAGTTACCCTTTGGATGGG - Intergenic
939294700 2:140245513-140245535 AGATATTTTAGCCTTTTTAATGG - Intronic
940351752 2:152698247-152698269 ATATCAGCTACGTTTTTTAAAGG - Intronic
940463049 2:153992032-153992054 ATAATTGTTACCCTTTTAAAGGG + Intronic
941411442 2:165161546-165161568 ACACCAGTTTCCCTTTTTAAAGG + Intronic
941579526 2:167277204-167277226 ATATGAGTTAACCTTGTCAAAGG - Intergenic
942340280 2:174936911-174936933 ATATAAATAATCCTTCTTAAAGG - Intronic
943135352 2:183903847-183903869 ACATAATTTATCTTTTTTAATGG + Intergenic
943153194 2:184139170-184139192 ATTTAATTTACCATTTTTATAGG + Intergenic
943294447 2:186118719-186118741 GTAGAAGTTACCCTTTTGTAAGG - Intergenic
943571344 2:189578914-189578936 ATATAAGTTTCCAATTTAAAAGG + Intronic
943899825 2:193419283-193419305 GTATAATTTACCATTATTAAGGG + Intergenic
943974554 2:194456777-194456799 ATATAAGTAACCCTAATTTAAGG - Intergenic
944947997 2:204712682-204712704 ATATTAGTTACTCTTTTACATGG - Intronic
945106905 2:206324772-206324794 ATAAAATTCACCCTTTTAAATGG - Intergenic
945590825 2:211728483-211728505 ATATAAATGACATTTTTTAAAGG + Intronic
945740723 2:213657731-213657753 ACCAAAGTTCCCCTTTTTAATGG + Intronic
946206746 2:218114608-218114630 TTATTAGTTAACCATTTTAAAGG - Intergenic
946265425 2:218537090-218537112 ATGTAATTGACCCATTTTAAGGG - Intronic
947185933 2:227455705-227455727 ATGTAATTTACCTATTTTAATGG - Intergenic
947343115 2:229160727-229160749 ATTGAAGGTACCCGTTTTAAAGG - Intronic
947850105 2:233280308-233280330 CCTTAAGTTACCCTTTTAAAAGG + Intronic
948736676 2:240012621-240012643 ATAAAATTCACCCATTTTAAGGG - Intronic
1168737588 20:156034-156056 ATATAAGAAATCCTTTTTAGAGG - Intergenic
1170329878 20:15197132-15197154 ATATGAGTGACTCTTTTTTAAGG + Intronic
1170411007 20:16091948-16091970 ATATAATTCACCCATTTAAAGGG - Intergenic
1170506653 20:17032906-17032928 ATATGAATTACCATATTTAAAGG - Intergenic
1170554757 20:17505981-17506003 TAATCAGTTACCCTTTTTTAAGG + Intronic
1171236316 20:23528000-23528022 ATGTAATTTAGCCCTTTTAAGGG - Intergenic
1172401685 20:34656934-34656956 GTAGAAGTTACCATTTGTAAAGG - Intronic
1173722721 20:45273593-45273615 GTATAAGTTCGCATTTTTAAAGG - Intergenic
1174029137 20:47607270-47607292 GTAGAAGTTACCCTTTTGTAAGG + Intronic
1177505143 21:22010552-22010574 ATATATTTTACATTTTTTAAGGG + Intergenic
1177820474 21:26025659-26025681 ATATAATTCACTCTTTTTCACGG - Intronic
1178219186 21:30636767-30636789 TTATAATTTATTCTTTTTAAGGG - Intergenic
1178446620 21:32649648-32649670 ATATAAATTAACATTTGTAAAGG + Intronic
1179228817 21:39481378-39481400 ATATGAGTTACTTTTTTTAATGG - Intronic
1179672529 21:42959786-42959808 GTATAAATTACCCTTTTGTAAGG + Intergenic
1180987644 22:19914775-19914797 ATAAAATTTAGCCTTTTTTAGGG - Intronic
1182143101 22:27979568-27979590 AGCTAAGTTACCTTTTTAAAGGG - Exonic
1182178794 22:28322516-28322538 TTATAAGTCACCTTTTGTAAAGG - Intronic
1183846225 22:40542755-40542777 TTATAAGTAGCCTTTTTTAATGG - Intronic
951008848 3:17652066-17652088 ATATGAGTTGGCTTTTTTAATGG - Intronic
951581337 3:24167223-24167245 ATATCAGTTGCAGTTTTTAAAGG - Intronic
951674895 3:25227323-25227345 AAATAAATTCCCCTTTTGAATGG - Intronic
952484584 3:33797675-33797697 TTATAATTTACATTTTTTAAAGG - Intergenic
952847876 3:37703460-37703482 ATATAATTGACCTTTTTTATAGG - Intronic
953258727 3:41316371-41316393 ATACAAGTCACCCATTTAAAAGG - Intronic
955112724 3:55965059-55965081 ATATGATATACCCTATTTAAGGG + Intronic
955145402 3:56313323-56313345 ATAAAATTTACCCTTTTAAATGG - Intronic
956126065 3:66011951-66011973 AAATGAGTTAACTTTTTTAAAGG + Intronic
956244065 3:67161213-67161235 ATATAAGGTAACCTATTTACAGG + Intergenic
956710403 3:72033972-72033994 GTAGAAGTTACCCTTTTGTAAGG - Intergenic
957353656 3:79055772-79055794 GTTTAGGTTACCCTTTTTAATGG + Intronic
957407157 3:79786877-79786899 AGATATGTGACCCTTTTGAAAGG - Intergenic
957909312 3:86602002-86602024 ATATAAGTTACTATTGTTAATGG + Intergenic
958648435 3:96903413-96903435 ATAAAAATTACACATTTTAAGGG - Intronic
959569074 3:107862705-107862727 TTATAACTTACTCATTTTAACGG + Intergenic
960479757 3:118173188-118173210 ATATAAGCTGCCATATTTAAAGG + Intergenic
960756044 3:121013799-121013821 TTTTAAGTTAACCTTTTTTATGG + Intronic
962585355 3:136837595-136837617 ATATAAATTACCCTTTTAGATGG + Intronic
963293707 3:143521272-143521294 ATAGCAGCTACCCTTTTTCAGGG + Intronic
963578182 3:147089888-147089910 ATATAAATTACCAATTTTGAGGG + Intergenic
964022604 3:152032139-152032161 ATAGTAGTTAACCTTGTTAAAGG + Intergenic
964664368 3:159155708-159155730 ATTTCAATTAGCCTTTTTAAAGG + Intronic
964885208 3:161474088-161474110 ATTAAAATTACCCTTTCTAAGGG - Intergenic
966012772 3:175101847-175101869 ATATAATTTCCTCTTCTTAATGG + Intronic
966100279 3:176260513-176260535 ATAGAATTTCTCCTTTTTAAAGG + Intergenic
967617865 3:191594664-191594686 ATATATGTTACTTTTATTAAAGG + Intergenic
970677048 4:18463028-18463050 ATATAAGATAACCTAATTAAAGG + Intergenic
971300626 4:25439644-25439666 ATATAATTTCCCCCTTTTGAAGG + Intergenic
971351257 4:25858075-25858097 AATTCAGTTACCCTGTTTAATGG - Intronic
971767930 4:30857763-30857785 ATATAAATTACCTGTTTTCAGGG - Intronic
972975471 4:44629602-44629624 AAATAAGTTACACTCTTTAAAGG + Intronic
973178224 4:47234662-47234684 ATTTAAGTTACCCTAATTTAGGG + Intronic
973642654 4:52918533-52918555 ATACATGTGACACTTTTTAATGG - Intronic
974787833 4:66643724-66643746 ATAAAAGTTAGCATATTTAATGG - Intergenic
975557414 4:75678116-75678138 TTATAAGTTACCCAGTTGAAGGG + Intronic
975770485 4:77716106-77716128 AGAAAAGTGACCTTTTTTAAAGG + Exonic
976176986 4:82364428-82364450 ATAGAAGTTACTATTTTGAAGGG + Intronic
976322727 4:83734079-83734101 GTAGAAGTTACCTTTTTGAAAGG + Intergenic
977222305 4:94352301-94352323 ATAAAATTCAACCTTTTTAAAGG + Intergenic
977318867 4:95485674-95485696 ATATTAGTTATCATTCTTAAAGG + Intronic
977652775 4:99489384-99489406 TTATATGTTAACCATTTTAAAGG + Intergenic
978647048 4:110946877-110946899 ATAGAAGTTTCCATTTTTACTGG - Intergenic
978666163 4:111184117-111184139 ATAGAACTTAACCTTATTAATGG + Intergenic
978759181 4:112336559-112336581 ATAAAATTTAACCATTTTAAGGG + Intronic
979131282 4:117048815-117048837 CTTTAAGTGACCTTTTTTAAAGG - Intergenic
979393117 4:120150482-120150504 AAAGAAGTTACTCTTATTAAAGG - Intergenic
979436596 4:120700614-120700636 ATATTAGTTGCATTTTTTAATGG - Intronic
980742538 4:136971250-136971272 ATATTATTTACCCTATATAATGG - Intergenic
980924897 4:139126449-139126471 ATATAAGCCACCCATTTGAAAGG + Intronic
981510749 4:145555180-145555202 ATATAGGTTAACCTCTTTAAAGG - Intronic
982865872 4:160511196-160511218 ATATAAGCTACCCTTTACCAAGG + Intergenic
984343147 4:178484998-178485020 AAATAAGATATTCTTTTTAATGG + Intergenic
985177964 4:187223059-187223081 CTGTAATTTACCATTTTTAAGGG + Intergenic
985500978 5:245035-245057 TTATATGTTAACCATTTTAAAGG - Intronic
985735884 5:1582491-1582513 TTATATGTTAACCATTTTAAAGG + Intergenic
985827913 5:2206371-2206393 ATTTGAGATACTCTTTTTAAAGG - Intergenic
986881624 5:12179608-12179630 ATATAACTTACCCTATTCATAGG + Intergenic
987062100 5:14252669-14252691 ATACAAGTAACCCCATTTAAAGG - Intronic
987223757 5:15818483-15818505 GTAAAAGTTACCTTTTTAAATGG - Intronic
987756711 5:22106033-22106055 ATAGAAGTTTCCATTTTTCATGG + Intronic
988304622 5:29479006-29479028 ATAAAAGTAACCATTTTTATAGG + Intergenic
988520754 5:31943485-31943507 ATTTTAGTTACCCTGTGTAATGG + Intronic
988948122 5:36228141-36228163 ATATAAGTTATCCTTTCTAAGGG - Intronic
988994658 5:36703335-36703357 AGTTAAGTTACCCTTGTGAAAGG - Intergenic
990915717 5:60902831-60902853 ATATAAGATAAACATTTTAAAGG + Intronic
990957273 5:61355150-61355172 ATATCAGTTTCCCTTGTCAAAGG + Intronic
991720479 5:69491031-69491053 ATAAAATTCACCCTTTTAAAGGG - Intergenic
993198937 5:84787636-84787658 TTATAAGGAACACTTTTTAAAGG - Intergenic
993989927 5:94643554-94643576 ATTTAAATGACACTTTTTAAAGG + Intronic
994011708 5:94911910-94911932 ATATATGTTACGCATTTAAAGGG - Intronic
994016114 5:94967279-94967301 ATCTAAGTTCCCTTTTATAATGG - Intronic
995691971 5:114837051-114837073 ATATATGTGACCATTTTAAATGG - Intergenic
996297979 5:121946135-121946157 ATCTAAGTTAGCCTTTTACATGG - Intergenic
996587480 5:125106758-125106780 ATATCATTTGCCCTTTTTCATGG - Intergenic
996591976 5:125158382-125158404 AGATAAGTTTTTCTTTTTAAGGG + Intergenic
996868747 5:128161010-128161032 ATATAATTTACCTTTTGTAGTGG - Intronic
996916408 5:128717144-128717166 ACATAATTTAACCTGTTTAAGGG + Intronic
998490013 5:142538719-142538741 ATAAAATTCACCCTTTTCAAGGG - Intergenic
1000091457 5:157932959-157932981 GTATAATTTACTCTTTGTAAGGG + Intergenic
1001257007 5:170191470-170191492 ATATGATTGACCCTTTATAAAGG + Intergenic
1003182525 6:3804421-3804443 AGAGAAGTTACCCTTTTGTAGGG - Intergenic
1003415583 6:5905072-5905094 ATCCAAATTACCCTATTTAAAGG - Intergenic
1003723743 6:8735547-8735569 ATACAAGTTATCTTTATTAAAGG - Intergenic
1004616912 6:17299491-17299513 ACATAATTTCCCCTTTTTAAAGG + Intergenic
1006530050 6:34644270-34644292 ATACATGCTACCATTTTTAAGGG - Intronic
1006658769 6:35621315-35621337 ATGTAATTTAGCCTTTTAAATGG - Intronic
1006970357 6:38037727-38037749 ATAAAGGTGAGCCTTTTTAAAGG - Intronic
1007183324 6:39946526-39946548 TTATAAATTACCCATTCTAAGGG + Intergenic
1008320203 6:50103076-50103098 TTATAAGTTACCTTTTTCAAAGG + Intergenic
1009025412 6:57993263-57993285 ATATATGTAAACATTTTTAAAGG - Intergenic
1009250370 6:61291339-61291361 TTATCTGTTACCCATTTTAAAGG + Intergenic
1009432083 6:63574967-63574989 ATGAAAGTTACCTTTTTTATGGG + Intronic
1009513931 6:64589849-64589871 ATATAACATACTCTTTCTAACGG - Intronic
1009648176 6:66436284-66436306 AAATAATTTATCCCTTTTAATGG - Intergenic
1009789828 6:68386896-68386918 TCATAAGTTATCCTTTTAAAGGG - Intergenic
1010217534 6:73417838-73417860 ATATAAGTTACCCTCATTTATGG - Intronic
1010404676 6:75490594-75490616 ATATAAGTTACAGTATTTAGAGG + Intronic
1011164270 6:84428576-84428598 ATAAAATTTATCCCTTTTAAAGG - Intergenic
1012068906 6:94586401-94586423 AAATAATTTGCCATTTTTAATGG + Intergenic
1012302288 6:97604513-97604535 ATATATGTTACCCCTTTTATTGG - Intergenic
1012634424 6:101518362-101518384 ATATAATTTTCTTTTTTTAAAGG + Intronic
1012808652 6:103928977-103928999 ATATGAGTTACTCTCTATAATGG - Intergenic
1013023301 6:106242091-106242113 ATATAATTTCCACTTTTTAAAGG - Intronic
1013501605 6:110757379-110757401 ATCTAGGTTATCCTTTTTTATGG - Intronic
1013536879 6:111071034-111071056 ATATATTTTAACCTTTTAAAAGG + Intergenic
1013830501 6:114267255-114267277 AGAAAAGGTACCCATTTTAAAGG + Intronic
1015000718 6:128211033-128211055 ATATAATTTATCCTTGTTATAGG - Intronic
1015873816 6:137802732-137802754 ATGTATGTAAACCTTTTTAATGG + Intergenic
1015916634 6:138224187-138224209 ATACAAGTTACCATTTATGATGG + Intronic
1018355798 6:163014672-163014694 ATGTATTTTACCCATTTTAATGG + Intronic
1019089226 6:169512379-169512401 ATTTAACTTACAATTTTTAAAGG + Intronic
1021296536 7:18914564-18914586 ATATAATTTAACATTTATAATGG + Intronic
1021396720 7:20158415-20158437 ATATAAGTCAATTTTTTTAAAGG + Exonic
1021586073 7:22210005-22210027 ATATATTTTCCCCTTTTTAGAGG + Intronic
1021669245 7:23018550-23018572 ATATCAGATTCCCTTTTTAAGGG + Intergenic
1023471136 7:40521376-40521398 TTATAATTTTCCCTTTCTAATGG + Intronic
1023783482 7:43681561-43681583 AAATAAGGTACAATTTTTAATGG + Intronic
1026300754 7:69095996-69096018 TTATAAATTACCCTTTTATAGGG - Intergenic
1027381501 7:77614660-77614682 ATATAGGTGACTCTTTTTATAGG + Intronic
1027533829 7:79370031-79370053 ATATAAATCACTCTTTTTAGTGG + Intronic
1027697327 7:81428343-81428365 ATAGCACTTACCATTTTTAATGG - Intergenic
1027801623 7:82759356-82759378 ATATAATTTACCCTTATTCCTGG + Intronic
1027968887 7:85051075-85051097 ATCTAAGTTACCCTTGTTTTTGG + Intronic
1030279384 7:107755740-107755762 AAAAAAGTTACTTTTTTTAATGG + Intronic
1031023774 7:116658001-116658023 ATATTAATTGCCCTTATTAAAGG - Intergenic
1031507339 7:122601896-122601918 ATTTAAGTCTCCCTTTTAAACGG + Intronic
1032530922 7:132619169-132619191 ATATACTTCACTCTTTTTAAGGG - Intronic
1032899251 7:136288262-136288284 ATATAATTTACCTTTTAAAAAGG + Intergenic
1034036749 7:147832014-147832036 AAATAAGTTAACATTTTTTAAGG + Intronic
1034160726 7:148992659-148992681 ATAAAATTAACCATTTTTAAGGG - Intergenic
1034291094 7:149932452-149932474 ATAAAATCTACCCTTTTAAAGGG - Intergenic
1034815009 7:154164485-154164507 ATAAAATCTACCCTTTTAAAGGG + Intronic
1035554255 8:553987-554009 ATATACGTTATCATATTTAATGG + Intergenic
1036087036 8:5623634-5623656 AAATAAGTTACCTTCTTTTATGG - Intergenic
1036603405 8:10284529-10284551 ATTTAAGTTTTCTTTTTTAAAGG - Intronic
1037218983 8:16493779-16493801 AAATAAAATACACTTTTTAAAGG + Intronic
1037895621 8:22652057-22652079 AAATAAGATACCATTTTAAAAGG - Intronic
1037955315 8:23052269-23052291 AAAAAAGTTACCCTTTAAAAAGG - Intronic
1038312956 8:26459177-26459199 GTAGAAGTTACTCTTTGTAAGGG + Intronic
1040352765 8:46585103-46585125 GTTTAGGTTATCCTTTTTAATGG + Intergenic
1040956141 8:52982031-52982053 TTATATGTTAACCATTTTAAAGG + Intergenic
1041108235 8:54461620-54461642 AAAGAATTTAACCTTTTTAAAGG - Intergenic
1041439229 8:57875758-57875780 ATTTTAGTTAGGCTTTTTAATGG + Intergenic
1041445087 8:57942216-57942238 AAATAAGTTACTTTTATTAATGG - Intergenic
1041693137 8:60709277-60709299 ACACAAGATTCCCTTTTTAAGGG - Intronic
1042351035 8:67777951-67777973 ATATATGTTAACATTTATAATGG + Intergenic
1043001256 8:74762888-74762910 ATATAAGTCACTCTCCTTAAAGG + Intronic
1043193749 8:77263191-77263213 ATATAAGTTCCTCTTTTGAGGGG - Intergenic
1043425944 8:80148977-80148999 AAATAACTTAAGCTTTTTAATGG - Intronic
1045028288 8:98110558-98110580 ATAAAAGTTACCCATTTTAATGG - Intronic
1045616702 8:103921991-103922013 ATAAAAGTTACATTTTGTAAAGG + Intronic
1045994492 8:108346682-108346704 TTATAAGTTAACCTTTCAAATGG - Intronic
1046095955 8:109560758-109560780 TTAAAAGATACTCTTTTTAACGG + Intronic
1046324570 8:112624037-112624059 CTATTACTTACACTTTTTAAAGG - Intronic
1046366435 8:113238254-113238276 ATCTAGGTCAACCTTTTTAAGGG + Intronic
1046574849 8:116014600-116014622 ATTTAATTTGCCCTTTTTACAGG + Intergenic
1046921194 8:119731046-119731068 ATATAAGCTCACCTTTTTAAAGG + Exonic
1049875874 8:145019964-145019986 ATGTAGGTTACCATTTTTAGGGG + Intergenic
1050304373 9:4293213-4293235 ATGTTTGTTACCCTTTTTGAAGG - Intronic
1050575486 9:6990711-6990733 ATATAAGCTAGCCTTATTACTGG + Intronic
1050656069 9:7830308-7830330 ATATAAGTTACCATATTTGCAGG - Intronic
1050840776 9:10146377-10146399 ATATAAATTACAGTTTTTCAGGG + Intronic
1051904637 9:22081120-22081142 ATATAAGCTACAGTTTTAAAAGG - Intergenic
1052168728 9:25366942-25366964 ATAATACTTACCCTGTTTAATGG - Intergenic
1052687601 9:31774709-31774731 GTTTAGGTTATCCTTTTTAATGG + Intergenic
1052815244 9:33097866-33097888 ATATCAAATACCCTTCTTAATGG + Intergenic
1055119250 9:72639491-72639513 ATATAATTTTCCTTTTTCAAAGG - Intronic
1055532977 9:77205434-77205456 ATTTAAGTTATTCTTTTTTATGG + Intronic
1055573017 9:77635619-77635641 ATATAAATTAACATTTTTGAGGG + Intronic
1055913736 9:81379184-81379206 ATATAAATTTCCATTTGTAAAGG + Intergenic
1056872386 9:90294177-90294199 ATATAAATTGCCCATTTAAATGG + Intergenic
1058290286 9:103232750-103232772 GTATTAGTTACAATTTTTAAAGG - Intergenic
1058336917 9:103841257-103841279 ATATTATTTACAATTTTTAATGG - Intergenic
1059018563 9:110548266-110548288 ATAATAGTTTCCATTTTTAAAGG + Intronic
1187025095 X:15426525-15426547 ATAAAAGTTACTGTTTATAATGG - Intronic
1187157134 X:16731142-16731164 AAATTAGTTACCCTTTAAAAAGG + Intronic
1188029402 X:25247653-25247675 ATAGAAGTCAGGCTTTTTAAAGG - Intergenic
1188079549 X:25819722-25819744 TTATAATTTCCCATTTTTAATGG - Intergenic
1188167792 X:26883586-26883608 AAATTAGTTACCCTTTAAAAAGG + Intergenic
1188323489 X:28770467-28770489 AAAAAGGTTACCCTTTTCAAAGG - Intronic
1188369806 X:29355166-29355188 GTAGAAGTTACCCTTTTGTAAGG - Intronic
1188475907 X:30591925-30591947 AGATAAATTACAGTTTTTAAAGG + Intergenic
1188823110 X:34798691-34798713 GTTTAGGTTATCCTTTTTAATGG + Intergenic
1189221330 X:39374891-39374913 CAAGAAGTTACCCTTTTAAAGGG - Intergenic
1189745501 X:44164522-44164544 ATCTAAATAACCCCTTTTAATGG - Intronic
1190030116 X:46963950-46963972 ATACAAATTACTCTTTTTTAAGG + Intronic
1190942390 X:55054947-55054969 AAATACGTTATCCTTTTTAAAGG - Intergenic
1191934362 X:66410470-66410492 AAATATGTTACCCTTTTTCAAGG - Intergenic
1192749547 X:73974939-73974961 ATATAATTTACTCATTTTAAGGG + Intergenic
1192811576 X:74552036-74552058 GTAGAAGTTACCCTTTTATAAGG + Intergenic
1193421394 X:81287021-81287043 CTCTAAGTTATCATTTTTAATGG - Intronic
1193814959 X:86093702-86093724 ATATATTTCACCATTTTTAATGG + Intergenic
1194437760 X:93889879-93889901 TTATAAGTTATCCATTTTTATGG + Intergenic
1195230045 X:102837586-102837608 ATATAATTTACGCATTTAAAGGG + Intergenic
1195233049 X:102870271-102870293 ATGAAATTTACCCATTTTAAGGG + Intergenic
1196539686 X:116892901-116892923 AGAAAAGTTAGCTTTTTTAATGG + Intergenic
1197127857 X:122969093-122969115 ATTTAATTTACATTTTTTAAAGG + Intergenic
1199217421 X:145276751-145276773 AGACAATTTACCCTGTTTAATGG - Intergenic
1199876636 X:151935263-151935285 ATATAAGTTAACTTTTCTAGAGG - Intergenic