ID: 1071615185

View in Genome Browser
Species Human (GRCh38)
Location 10:87069030-87069052
Sequence ATAATTCCAAGTAATTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 2, 2: 2, 3: 31, 4: 371}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071615185_1071615186 -6 Left 1071615185 10:87069030-87069052 CCATGTAAATTACTTGGAATTAT 0: 1
1: 2
2: 2
3: 31
4: 371
Right 1071615186 10:87069047-87069069 AATTATCATGAACATACATATGG No data
1071615185_1071615188 5 Left 1071615185 10:87069030-87069052 CCATGTAAATTACTTGGAATTAT 0: 1
1: 2
2: 2
3: 31
4: 371
Right 1071615188 10:87069058-87069080 ACATACATATGGAAAAAGGCAGG No data
1071615185_1071615187 1 Left 1071615185 10:87069030-87069052 CCATGTAAATTACTTGGAATTAT 0: 1
1: 2
2: 2
3: 31
4: 371
Right 1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071615185 Original CRISPR ATAATTCCAAGTAATTTACA TGG (reversed) Intronic
901170510 1:7253614-7253636 ATAATACCATGTACTTTGCATGG - Intronic
903008861 1:20316523-20316545 ATGCTGCCAAGTATTTTACAAGG + Intronic
904960123 1:34326038-34326060 ATAGTTCTAAGTGCTTTACATGG + Intergenic
905219080 1:36431568-36431590 ATATTTCCAAGAAACTCACAAGG + Intronic
906595008 1:47068244-47068266 ATAATTTCACTTAATTTTCATGG + Intronic
907477766 1:54717286-54717308 CTAATTCCAAATATCTTACAAGG - Intronic
907758604 1:57335643-57335665 ATAATTCCTTGAAATTTACATGG + Intronic
907780276 1:57560391-57560413 ATAAATCCAAGTAAAATTCAGGG + Intronic
908722308 1:67138711-67138733 AAAATTCCCATTAAGTTACAAGG - Intronic
908823556 1:68112825-68112847 ATCATTCCAAGCAATTACCATGG + Intronic
908866204 1:68551343-68551365 ATGATTCCAAATAATTGAAAAGG + Intergenic
909216189 1:72893095-72893117 ATAATAACAAATAATTTGCAAGG - Intergenic
909507243 1:76406902-76406924 ATTATTCCACATAATTTTCATGG - Intronic
910356945 1:86368858-86368880 ATATTACAAAGTAATTTAAAAGG + Intronic
910900805 1:92118657-92118679 AGAATTCCAAATAATTTATGTGG - Intronic
911241684 1:95474738-95474760 ATTGTTCCAAGTCACTTACATGG + Intergenic
911703252 1:100980397-100980419 AAAATTACAAATAATTTTCAAGG - Exonic
912105696 1:106271038-106271060 ATAATTCCAAGAAATTGAAGAGG - Intergenic
913046456 1:115077383-115077405 ATAATTCCAAGTCATTAAATAGG + Intronic
916194122 1:162207526-162207548 GTAATACCAGGTACTTTACAGGG + Intronic
916501516 1:165391554-165391576 ATAATACCATATAATTTCCATGG + Intergenic
917356096 1:174128006-174128028 ATTATTCCAAATAATTGAAAAGG - Intergenic
917893935 1:179467814-179467836 ATAAAGACAAGTAATTTAAAAGG - Intronic
918830378 1:189388355-189388377 ATAATGGTAAGTATTTTACAAGG - Intergenic
919197783 1:194311151-194311173 ATAATTCCCAGTACTTTTCCAGG - Intergenic
919230090 1:194762997-194763019 ATAATTCCAACTAAAATTCAGGG - Intergenic
919277176 1:195435393-195435415 ATAATTCCATGTTATTCTCATGG + Intergenic
919572061 1:199261175-199261197 ATAATTCCAAGTAGGTCACATGG - Intergenic
919710542 1:200722894-200722916 ATAAATAAAAGTAATTTAAAAGG + Intergenic
920723363 1:208410861-208410883 ATAATCAAAAGTAATTTAGAAGG + Intergenic
921314239 1:213875436-213875458 ATGATTCCCAGTAATGTCCAAGG + Intergenic
922275546 1:224074469-224074491 ATAAAACCAAGTAATTTATCAGG + Intergenic
924108391 1:240672477-240672499 ATTATAACAATTAATTTACAGGG + Intergenic
924868491 1:248012839-248012861 AAAATTCCAAATATTTTAAATGG + Intronic
1064723401 10:18252590-18252612 ATAATTTAAGGCAATTTACAAGG - Intronic
1064848126 10:19679197-19679219 ATTATTCCAAACAATTAACAAGG - Intronic
1065431877 10:25666804-25666826 AAAATTCCCTGTAATGTACAGGG + Intergenic
1065881551 10:30041659-30041681 ATAATTACAAGTTATTCTCATGG + Intronic
1066127142 10:32352448-32352470 ATGATTCTAAGTGCTTTACATGG - Intronic
1066671157 10:37841573-37841595 AGAATTCCTAATAATTTATATGG + Intronic
1068711988 10:60145221-60145243 TTAATCCCATGTAATTTGCAGGG - Intronic
1068853440 10:61771147-61771169 AGAATTCCAAATAAATTATATGG + Intergenic
1068920412 10:62477508-62477530 ATAATGCCAAGTAATGTGCCTGG - Intronic
1070490490 10:76971320-76971342 ATAATACCAAGTAGCTGACATGG - Intronic
1070994700 10:80766400-80766422 ATAATTCCATGAAATGTAAATGG - Intergenic
1071615185 10:87069030-87069052 ATAATTCCAAGTAATTTACATGG - Intronic
1073516090 10:104076799-104076821 TTACTTCCAAGTATTTTAAATGG + Intronic
1073715182 10:106097910-106097932 ATAATCACAAGTATTTTATAAGG - Intergenic
1075235520 10:120724247-120724269 AGAACTCCAAGTAATTTATGTGG - Intergenic
1075839271 10:125485668-125485690 ATATTTCCAAATAATTTATGTGG + Intergenic
1077621504 11:3728860-3728882 CAGATTCTAAGTAATTTACAGGG + Intronic
1077680435 11:4235489-4235511 GTAAGTCCATATAATTTACATGG - Intergenic
1078054053 11:7992674-7992696 AAAATTCCAAGTCACTTACAAGG - Intronic
1079427041 11:20353332-20353354 ACAATTCCAAGCACTTTACGTGG + Intergenic
1080251754 11:30241495-30241517 ACATTACCAAGTAATCTACATGG - Intergenic
1080576112 11:33600584-33600606 ATACTTCCTGGAAATTTACAAGG + Intronic
1083283053 11:61639252-61639274 ACTATTCCAGGTACTTTACAGGG - Intergenic
1087482893 11:98723418-98723440 ACAATTCCAAACAATTTAAAAGG - Intergenic
1088061466 11:105656187-105656209 ATAATTTAAACGAATTTACAAGG - Intronic
1090112616 11:123930780-123930802 AGAATGCCAAGTAATTTAGGTGG - Intergenic
1090621303 11:128563340-128563362 ATAATACAAAGTTATTTCCATGG - Intronic
1090961741 11:131563303-131563325 TTAACTCCAAGTAATTTATCGGG + Intronic
1092370380 12:7912085-7912107 TAAATTCCAAATATTTTACATGG - Intergenic
1092699094 12:11207026-11207048 ATAATTAAAAGTAATTTGTAGGG - Intergenic
1094029723 12:25997506-25997528 ATAATTCCATTAAATCTACATGG - Intronic
1094101267 12:26766526-26766548 ATATTTCCAAATAATTTATCTGG - Intronic
1094116159 12:26915693-26915715 TTAATTTCTAGTAATTTAAATGG - Intronic
1095107011 12:38246480-38246502 ATAATTGCAATTAATTTTCAAGG - Intergenic
1095142197 12:38678293-38678315 ATAATACTCAGTAATTTAGAGGG + Intronic
1095335555 12:41021128-41021150 AAAATTCAAAGGAATTAACATGG + Intronic
1097411898 12:59265564-59265586 CTAATTCCAAGTTACTTACTTGG - Intergenic
1097422180 12:59393650-59393672 ATTATTCCAAGCAATTGAAAAGG + Intergenic
1097474885 12:60041503-60041525 ATAATTTTAATTAATTTACATGG + Intergenic
1097479391 12:60102205-60102227 ATAATTCCAATTAATCTACTTGG + Intergenic
1097922498 12:65091368-65091390 ATTATTCCCAGTATTATACAAGG + Intronic
1098532688 12:71558476-71558498 AGAAATCCAAGTAATTTATAAGG + Intronic
1098553008 12:71785166-71785188 ATTATTCCAAGTAATATTTAGGG - Intronic
1098620528 12:72592598-72592620 ATTTTTCCAAGTAATTTTCTTGG + Intronic
1098760041 12:74411689-74411711 CTAATGCCATATAATTTACAAGG - Intergenic
1098788954 12:74795801-74795823 ATCATTCCATGTATTCTACAAGG - Intergenic
1099251290 12:80258104-80258126 ATTATCCCAAGAGATTTACATGG + Intronic
1099349188 12:81543546-81543568 AGAATTCAAAATAATTTATATGG + Intronic
1099479371 12:83146990-83147012 ATAATTCCAATTCATTTATAAGG - Intergenic
1099591368 12:84595188-84595210 ATAATTAAAAATAATATACAGGG - Intergenic
1099623983 12:85044275-85044297 ATAATTCCTCTTCATTTACATGG + Intronic
1099727893 12:86457902-86457924 AAAATTCCCATTTATTTACATGG - Intronic
1101178726 12:102186647-102186669 ATAAAGCCAATTAATTCACAGGG - Intronic
1101506790 12:105354529-105354551 ATAATGCCAAGTATTTTCCTAGG - Intronic
1102109611 12:110355121-110355143 AGAATTCCAAGTAATTTACATGG + Intergenic
1104523058 12:129493359-129493381 ATTATTCTAAGTGATTTACGTGG + Intronic
1105516639 13:21096841-21096863 ATATTTTAAAGTAAATTACAAGG + Intergenic
1105666783 13:22568186-22568208 ATAATTCCATTTAATCTAAATGG - Intergenic
1105949306 13:25215169-25215191 AGAATTCCAAATAATGTATATGG + Intergenic
1106282718 13:28289946-28289968 ATAATGCCAAGTAATTCATAAGG - Intronic
1106310795 13:28552425-28552447 ATTATTGCTAGTTATTTACATGG - Intergenic
1106716417 13:32393321-32393343 AGAATTCCAATTAATGTAGAAGG - Intronic
1106795387 13:33199983-33200005 ATAATTCCAAGTAGCTTTTATGG + Intronic
1107191193 13:37588753-37588775 ATAATACTAAGAAATTTAGAAGG + Intronic
1107796483 13:44057944-44057966 ACAATTCCAAGTAATTCATGTGG + Intergenic
1108533920 13:51353354-51353376 ATTGTTCCAAGCACTTTACAAGG + Intronic
1109490579 13:63093631-63093653 ATAATTCCAGAAAATTTGCAAGG + Intergenic
1109553493 13:63937583-63937605 ATTATTCCAAATAATTGAAAAGG + Intergenic
1109558369 13:64012523-64012545 AGAATTCCAAGTAATTTATGAGG - Intergenic
1109712745 13:66181291-66181313 ATAAATCCAACTAAAATACAGGG - Intergenic
1110029723 13:70593917-70593939 CTCATTCCAAGCAATTTTCAGGG - Intergenic
1110105546 13:71671014-71671036 ATAATTCTAAGTAAAGTTCAAGG + Intronic
1111512244 13:89281428-89281450 ATAACACCAAGTGATTTAAAGGG - Intergenic
1111605597 13:90534820-90534842 ATAATTCCCAGGACTTGACAGGG + Intergenic
1111727738 13:92033833-92033855 AGAAATCCCAGTAATTTACAAGG + Intronic
1114395545 14:22356291-22356313 AGAATTCCAAATAATTTACTTGG + Intergenic
1114678931 14:24467015-24467037 TTAATTCCAGGTGATCTACATGG - Intergenic
1114869639 14:26640680-26640702 ATAACTTAAAGAAATTTACAAGG - Intergenic
1116674323 14:47886271-47886293 GTAATTCCAATTTATTTAAAAGG - Intergenic
1117569954 14:57037797-57037819 AAAATGCCAAATAATTTATAGGG + Intergenic
1117883485 14:60335010-60335032 ATAATTTAAAGCATTTTACATGG - Intergenic
1118073089 14:62267710-62267732 ATAATTCAGAGTATTTTCCAGGG + Intergenic
1118283357 14:64449149-64449171 AATTTTCCAAGTATTTTACATGG + Intronic
1119039716 14:71262316-71262338 ATAATTCAAAGTCAGTTACTTGG - Intergenic
1120541366 14:85754816-85754838 ACAACTCCAAGAAATATACAGGG - Intergenic
1124195345 15:27621066-27621088 ATGATTCCAAGTAATCTCCATGG - Intergenic
1124820302 15:33038678-33038700 ATAATTCCAAATAATTTATCTGG - Intronic
1125252102 15:37716417-37716439 TTTATTCCAAGTAATAAACATGG - Intergenic
1126209430 15:46083753-46083775 CTAGTTTCCAGTAATTTACATGG + Intergenic
1126272544 15:46838185-46838207 AAAATTCCAAGTAATTTATGTGG + Intergenic
1126525113 15:49645226-49645248 ACAATTCCTATTAATATACATGG + Exonic
1128906218 15:71470194-71470216 ATAATTACTACTAATTTATAAGG + Intronic
1130425205 15:83790750-83790772 AAAATCCCAAGAAATCTACAAGG + Intronic
1133659115 16:7897621-7897643 ATAGTTCCAAGGAATGTACATGG + Intergenic
1133700730 16:8305998-8306020 ATGATTCTAATTGATTTACATGG + Intergenic
1135003434 16:18797548-18797570 ATATTTCACAGTACTTTACAGGG + Intronic
1135165176 16:20132864-20132886 GTAATTCCACGTAAATTTCACGG + Intergenic
1135186128 16:20317126-20317148 ATAATTCCAATAAATATATATGG + Intronic
1137065158 16:35832938-35832960 ATTATTCCAAACAATTTAAAAGG - Intergenic
1138267980 16:55673868-55673890 AGAATTCCAATTAATCTAGAAGG - Intronic
1138974315 16:62185235-62185257 ATTATTTCAAGTAAATTTCAAGG + Intergenic
1139026965 16:62829948-62829970 ATAATTTGCAGTAGTTTACATGG - Intergenic
1141243310 16:82283350-82283372 ATTATTCCATGTGGTTTACATGG - Intergenic
1142437090 16:90067315-90067337 ATGATTCCAAGTATTATCCAAGG + Intronic
1142542796 17:673815-673837 ATAAATAAAAGTAACTTACATGG - Intronic
1142918733 17:3165594-3165616 ATAATTTCAACTAATGTATAAGG + Intergenic
1146085726 17:29827189-29827211 ACAAATCCAAGCAAGTTACAAGG + Intronic
1146545766 17:33736820-33736842 ATCATACCATGTACTTTACACGG + Intronic
1148239395 17:45990196-45990218 AGAATTCTAACTATTTTACACGG - Intronic
1149329846 17:55569419-55569441 AAAATTACAAGAAATTTAGAAGG - Intergenic
1149980673 17:61308846-61308868 ATAATGCCAAGTAATAAAGAAGG - Intronic
1151687034 17:75653570-75653592 ATAATTCACAGTATTTTAAAAGG - Intronic
1153434506 18:5054893-5054915 ATAATCCTAATTAATTTCCATGG - Intergenic
1154328666 18:13411398-13411420 CTACTTCCAAGTATTTTACTTGG + Intronic
1155411077 18:25545778-25545800 ATAATTACATGGAATGTACATGG + Intergenic
1157759132 18:50246705-50246727 ATAATTGCAAGTCATTTATCTGG + Intronic
1158131815 18:54160569-54160591 ATAACTCCAAGTCATTAAAAAGG + Intronic
1158678028 18:59540373-59540395 ATTATTTCAATTTATTTACAAGG - Intronic
1158977044 18:62718496-62718518 AAACTTCCAAGAAATTTAAAGGG - Intronic
1159292887 18:66445369-66445391 ATAATTCCCAGTAATTTGGGAGG + Intergenic
1168372655 19:55849157-55849179 AGAATTCCAAGTAGCTTAGATGG - Intronic
925518604 2:4714462-4714484 ATAAAACTAAGTAATTTAGATGG - Intergenic
925819302 2:7784017-7784039 ATATTTCCAGTTAATTTACTGGG + Intergenic
926402945 2:12517811-12517833 ATAATGCCAAGAAAAATACAAGG + Intergenic
926831663 2:16969428-16969450 ATAATTCTAAGTAAATTGCAGGG - Intergenic
927403850 2:22745771-22745793 ATAATTTCAAGGACTTTAGATGG + Intergenic
928481318 2:31687169-31687191 ATAATTAAAATTACTTTACAGGG - Intergenic
928909201 2:36401684-36401706 ATAATTCCAAGTTGGGTACATGG + Intronic
930443566 2:51441258-51441280 ATAATTTCTAGTGATTTAAAGGG - Intergenic
930497337 2:52162861-52162883 ATGATGCCAAGTAATTTAAATGG + Intergenic
932501137 2:72183616-72183638 ATAATTCTAAATAATTTCCAGGG + Intronic
933331132 2:80894683-80894705 ATAATTTTAAGTCATTTACGTGG - Intergenic
933467367 2:82671084-82671106 ATAATTCAAAATAAATCACAGGG - Intergenic
935621258 2:105131759-105131781 AAAATTCCAAAGAATCTACATGG + Intergenic
935979434 2:108612506-108612528 ATAATTCCATGTACTCTAAAAGG + Intronic
937861356 2:126713982-126714004 ATAATTCCTAGTCTTTGACAGGG - Intergenic
938301745 2:130219474-130219496 ATAATTTCAAGTGTCTTACAGGG + Intergenic
938454955 2:131454977-131454999 ATAATTTCAAGTGTCTTACAGGG - Intergenic
939282607 2:140084128-140084150 AAATTGCCAAGTAATTGACAAGG + Intergenic
939666722 2:144962114-144962136 GTAATTCAAAGAAATTGACATGG + Intergenic
939712791 2:145543816-145543838 AGACTTCAAAGTAATTTAAAGGG - Intergenic
940302263 2:152187380-152187402 ATAATCCCATTTAATTTTCACGG - Intergenic
940415956 2:153420418-153420440 ATAATTCAAAAAAATTTAAAAGG + Intergenic
941012316 2:160314688-160314710 CCAATTCCAAGTAATATATAAGG - Intronic
941082910 2:161082462-161082484 ATAAGTTCATTTAATTTACAAGG + Intergenic
941355193 2:164482508-164482530 ATAGTTCCAAGTTACTTATAAGG - Intergenic
941738103 2:169002830-169002852 ATAAGTTCAAGAAATTTACTGGG + Intronic
941744548 2:169073152-169073174 ATAATGCCAAGTATCATACAAGG + Intronic
942576293 2:177366981-177367003 ATGATTACAAGTATTTAACATGG - Intronic
942893823 2:181025114-181025136 AAAATACCAAATAATTTATAGGG + Intronic
942915468 2:181300665-181300687 ATAATTCCAATTGAATTACTTGG + Intergenic
943305354 2:186255016-186255038 ACTATGCCAAGTGATTTACATGG - Intergenic
943809643 2:192168747-192168769 AGAATTTCAAATAATTTAAATGG + Intronic
943931714 2:193862797-193862819 TTAATGCCCAGTAATTTACATGG + Intergenic
944068051 2:195639891-195639913 AGAATTCCAAATAATTTATGTGG - Intronic
945755038 2:213835316-213835338 ATAATTCTCTGTAACTTACATGG - Intronic
945847441 2:214963516-214963538 ATTATTCCAAATAATTGAAAAGG + Intronic
1169930770 20:10830531-10830553 ATTATTTGTAGTAATTTACAGGG - Intergenic
1170530570 20:17287355-17287377 ATATTTGCAAGTATTTTTCACGG - Intronic
1171060885 20:21958004-21958026 ATAAATCCAACTAAGCTACAAGG - Intergenic
1173365659 20:42382451-42382473 ATATTGCCAAGTGATGTACAGGG - Intronic
1173429489 20:42973499-42973521 ATAATTGCAGATAATCTACAGGG - Intronic
1174814737 20:53676987-53677009 ATAATTCCAAGAATTTGAAAGGG - Intergenic
1177051228 21:16237456-16237478 ATAATTCTAACTAAAATACAAGG - Intergenic
1177315072 21:19449242-19449264 ATACTTCCTATTAATGTACATGG - Intergenic
1177428937 21:20963912-20963934 ATAATTACAAATATTTTACATGG + Intergenic
1178163206 21:29942183-29942205 ATGATTCCAACTAATTGAAAAGG - Intergenic
1178730844 21:35101250-35101272 AGAATTCCAGGTAATATGCAGGG - Intronic
1178953184 21:37002142-37002164 AGAATTCCAAATAATTTATGTGG - Intergenic
1179045539 21:37841813-37841835 AAAATTCTAAGTAAATTAAATGG - Intronic
1179396405 21:41044110-41044132 ATACTTACAAGTAATGAACAAGG - Intergenic
1182636402 22:31730797-31730819 AGAATTCCAATTAATATATATGG - Intronic
1183132358 22:35850931-35850953 ATAATTCTAAATAAGTTTCAGGG + Intronic
949282614 3:2363780-2363802 ATAATTTAAAGTAATCTTCAAGG + Intronic
949633735 3:5958996-5959018 ATAATTCCAATTCATAAACAAGG + Intergenic
949729170 3:7088087-7088109 ATACTTCACAGTAATTTTCATGG - Intronic
951036443 3:17938010-17938032 ATAATCCTAAATAAATTACATGG + Intronic
953213038 3:40893269-40893291 TTAAGTGCAAGTAATTTATATGG + Intergenic
953720886 3:45354267-45354289 AAAATTTCAGGAAATTTACATGG + Intergenic
954097281 3:48338564-48338586 GTAATTCCACTAAATTTACATGG + Intergenic
954938660 3:54350744-54350766 AAAATTCACAGTATTTTACAAGG - Intronic
955873968 3:63471022-63471044 AAAACTCCAAGTTACTTACATGG - Intronic
956036171 3:65094616-65094638 AAAATTACAGGTAATTAACAGGG + Intergenic
957475903 3:80723741-80723763 AGAAAAGCAAGTAATTTACAAGG - Intergenic
957684267 3:83480213-83480235 AAAATTCCAAGTAATTTACATGG - Intergenic
959131183 3:102357953-102357975 AAAATTTGAAGTAAATTACATGG + Intronic
959264826 3:104124053-104124075 ATCATCCCAAGAAATCTACAGGG - Intergenic
960076217 3:113488797-113488819 GTATTTCCAAATAATTTGCAGGG - Intronic
963484004 3:145913281-145913303 ATAACTACAAGTAACTTAAATGG - Intergenic
963630250 3:147722763-147722785 ATAAATCCAACTAAATTTCAGGG + Intergenic
963720991 3:148861903-148861925 AAAATTCCAAGGAATTTTTAAGG + Intergenic
963999043 3:151746062-151746084 AGATTTCCAATTAATGTACATGG + Intronic
964097726 3:152952470-152952492 AGAACCCCAGGTAATTTACATGG + Intergenic
964965697 3:162490028-162490050 ATAATTCCAACTAATTGGGAGGG - Intergenic
965041226 3:163509329-163509351 ATAATTCCACATTATTTAGAAGG + Intergenic
965196191 3:165598330-165598352 AAAATTAACAGTAATTTACAAGG - Intergenic
965271704 3:166624878-166624900 ATAATTCCAAATTATTTATCAGG - Intergenic
966539308 3:181071884-181071906 ACTATTCCAAATAATTTAAAAGG - Intergenic
967657310 3:192066188-192066210 ATATTTTAAAGTAATTTAAAAGG - Intergenic
968389167 4:174735-174757 AAAAATTCAAGTAATTTCCAAGG + Intergenic
970705470 4:18796298-18796320 ATCATTCCAATTAATTTTTAAGG - Intergenic
972625421 4:40793024-40793046 ATAATTCCAAGTCGTTAGCAAGG - Intronic
972840315 4:42922700-42922722 ATATTTACAAGCCATTTACAAGG - Intronic
972883039 4:43448623-43448645 ATAAATCCAAGTAAAATTCAGGG - Intergenic
973291981 4:48480540-48480562 CTAATTCCAAGTAGATTAAAGGG - Intergenic
973783182 4:54309677-54309699 AAAATTCTAAGGAATATACAAGG - Intergenic
973996276 4:56462698-56462720 AGAATTCCAGGTAATTCTCATGG - Intergenic
974100690 4:57412709-57412731 ATTATTCAAAGTAAATTTCATGG - Intergenic
974554147 4:63421501-63421523 TTAATTAAATGTAATTTACAGGG + Intergenic
974735732 4:65929135-65929157 AAAATACCTAGGAATTTACAAGG + Intergenic
976097324 4:81523012-81523034 ATAATGTCCAATAATTTACAAGG + Intronic
976762331 4:88563116-88563138 ATTATTCCAATTTATGTACATGG + Intronic
976971801 4:91112809-91112831 ATAATTACAAGACATTTTCATGG + Intronic
977073664 4:92425814-92425836 AAAATGCCAACTAACTTACAAGG + Intronic
978297855 4:107228722-107228744 ATAATTACAATTACTTTTCAAGG + Intronic
978584239 4:110260587-110260609 ATATTTCCGTGTGATTTACAAGG + Intergenic
979291402 4:118982612-118982634 ATATCTGCAAGTAATTTACTGGG - Intronic
980256552 4:130387478-130387500 TTAATTGCAAGTAATTAAAAAGG + Intergenic
980403009 4:132317520-132317542 ATATTTCTATGTACTTTACATGG - Intergenic
981022618 4:140044880-140044902 TTAATTTCAAGTAGCTTACATGG - Intronic
981423698 4:144580069-144580091 TCAACTCAAAGTAATTTACAGGG + Intergenic
983582600 4:169324341-169324363 ATAAATCCAACTAAGTTTCAGGG + Intergenic
983924056 4:173377654-173377676 AAACTTCCAAGAAATTAACAGGG + Intergenic
984014519 4:174409786-174409808 ATGATTTCAATTACTTTACATGG - Intergenic
984348817 4:178565755-178565777 ATATTTCTAACTAATTTTCATGG - Intergenic
984735141 4:183100426-183100448 ATAATTCTAAGAAATTTTAAGGG - Intronic
986140895 5:5028648-5028670 ATTATTCCAAATAATTGAAAAGG + Intergenic
986222686 5:5783540-5783562 ACTATTCAAAATAATTTACAAGG + Intergenic
986470162 5:8065505-8065527 ATAATTGCAAAGAATTTTCAAGG - Intergenic
986986943 5:13511233-13511255 ATAATCCCAAGTGATTTTCAGGG + Intergenic
987119548 5:14753918-14753940 ATATTTCAAAGTACTTTGCATGG + Intronic
987269557 5:16292424-16292446 AGAATTCCAAATAATTTACACGG - Intergenic
987638924 5:20585743-20585765 AATATTCCAAGTAATCTACTAGG + Intergenic
987699018 5:21370739-21370761 ATAATTCCTAAAAATTTACATGG - Intergenic
988085136 5:26465836-26465858 ATGATTCCAAGTACTCTAGAAGG - Intergenic
988164311 5:27563731-27563753 GCAATTCCAAATAATTTACTAGG + Intergenic
988635607 5:32980215-32980237 ATAATTCCATGTATTCAACAAGG + Intergenic
988710392 5:33768617-33768639 ATTATTCCAAATAATTTATAAGG + Intronic
988753636 5:34220738-34220760 ATAATTCCTAAAAATTTGCATGG + Intergenic
989045282 5:37268074-37268096 ATAAATCCAAGTAAAATTCAGGG - Intergenic
989787946 5:45353767-45353789 TTAGTTCTCAGTAATTTACAGGG - Intronic
990980314 5:61596778-61596800 ATTATTCCATATTATTTACATGG - Intergenic
991456736 5:66811945-66811967 ACATCTCCAAGTATTTTACAGGG + Intronic
991741421 5:69681592-69681614 ATAATTCCTAAAAATTTGCATGG + Intergenic
991756197 5:69872847-69872869 ATAATTCCTAAAAATTTGCATGG - Intergenic
991792995 5:70261330-70261352 ATAATTCCTAAAAATTTGCATGG + Intergenic
991820880 5:70557666-70557688 ATAATTCCTAAAAATTTGCATGG + Intergenic
991835600 5:70748764-70748786 ATAATTCCTAAAAATTTGCATGG - Intergenic
991885444 5:71261635-71261657 ATAATTCCTAAAAATTTGCATGG + Intergenic
992159134 5:73983655-73983677 CCAATTCCAATCAATTTACAAGG + Intergenic
992948969 5:81838043-81838065 ACAGTTCCCAGCAATTTACATGG + Intergenic
993168758 5:84388469-84388491 AAAATTCCAGGTAATTTAATGGG - Intergenic
993367542 5:87051422-87051444 ATAAATCCAACTAAAATACAGGG - Intergenic
993475028 5:88354190-88354212 ATAATTTCAATTATTTTACTTGG + Intergenic
994238176 5:97390264-97390286 AGAATTCCAAATAATTTATGTGG - Intergenic
994803243 5:104407273-104407295 ATAATTTAAAGTAGTTTTCAAGG - Intergenic
994956293 5:106537068-106537090 ATTATTCCAAAAAATTGACAAGG - Intergenic
995164285 5:109020543-109020565 AAAATTCCAAGTCATATAGAAGG - Intronic
995748940 5:115433818-115433840 GAACTTCCAAGTAATTTAAATGG + Intergenic
995925773 5:117371194-117371216 ATAATTCAAAGCAATTTAAAGGG - Intergenic
996457707 5:123703787-123703809 ATAATTCCTAGTTATTTTCCTGG - Intergenic
996535168 5:124570201-124570223 ATAATTCCAGTGAATTTACTTGG - Intergenic
996920938 5:128766877-128766899 ATATTGCCTAGTAATTTCCAAGG + Intronic
997026189 5:130064721-130064743 ATTCTTCCAAGTGATTTGCAGGG + Intronic
998478206 5:142439360-142439382 ATATTTCCGAGTAATTCCCATGG + Intergenic
1000670467 5:164056210-164056232 AGAATGACAAATAATTTACATGG + Intergenic
1001141808 5:169150822-169150844 AGAATGGCAGGTAATTTACAGGG - Intronic
1002144472 5:177168099-177168121 AAAATTCCAAGTAATGAACTTGG + Intronic
1002463768 5:179392507-179392529 ATACTTCTAAATAATTTATATGG + Intergenic
1003245601 6:4379382-4379404 ATAATTCCATCTAGTTTTCATGG - Intergenic
1003736242 6:8880583-8880605 TTAACTCAAAGTAATTTACGTGG - Intergenic
1004924971 6:20407427-20407449 ATTCTTCCAAGTAATACACAAGG - Intronic
1005150803 6:22748239-22748261 AAAAAACCAAGTGATTTACATGG - Intergenic
1005551806 6:26927570-26927592 ATAATTCCTAAAAATTTGCATGG + Intergenic
1005687395 6:28267893-28267915 AAAATTCCAAGTAATTCAGGTGG + Intronic
1008707898 6:54185552-54185574 ATAATTCCAAATTATTATCATGG - Intronic
1009554449 6:65144888-65144910 ATAATCCCAACTACTTTACTTGG - Intronic
1010080638 6:71856916-71856938 AGAATTCCAAATAATTTATGTGG - Intergenic
1010468653 6:76199199-76199221 ACAATTCCAAATAATTGAAAAGG + Intergenic
1010914844 6:81603194-81603216 ATCATTCCAAGCAATTGAAAAGG + Intronic
1010955490 6:82086397-82086419 ATAAGTTCAAGAAATTTATATGG + Intergenic
1011221589 6:85060416-85060438 ATCCTTCCAAGTAATTTTCTAGG + Intergenic
1011979437 6:93354163-93354185 ATAATTTCAAGGGTTTTACAGGG + Intronic
1013062668 6:106652188-106652210 ATAATTCCATTTAAATTCCAGGG + Exonic
1013334828 6:109146380-109146402 ATAATTTCTACTAATTAACATGG - Intronic
1014037268 6:116781301-116781323 CTATTTCCAAATAATTCACATGG + Intergenic
1014156840 6:118120623-118120645 ATAATTCAAAATAATGAACAAGG + Intronic
1014965131 6:127738867-127738889 ATAATTCCAAGTTAATTCCTTGG + Intronic
1014979793 6:127932457-127932479 AGAATTCCAAATATTTTATATGG + Intergenic
1015324589 6:131909827-131909849 ATAATTACAAGTGTTTAACATGG + Intergenic
1015357811 6:132299973-132299995 ATAACTCCAAGAAATTAATAAGG - Intronic
1015887719 6:137935924-137935946 ATATTTGCAAATAATTTATATGG - Intergenic
1015958396 6:138621974-138621996 ATAATGCCACCTAATTTGCAGGG + Intronic
1016169136 6:140987295-140987317 ATAAATGCAAGTAATTTGGAGGG + Intergenic
1016234619 6:141848473-141848495 CTAATTCCAAGTAGATTATATGG + Intergenic
1016792771 6:148083271-148083293 ATAATTCCAAGTAACCCACAAGG - Intergenic
1017223127 6:151989122-151989144 ATATTCCCACTTAATTTACATGG - Intronic
1018617302 6:165699597-165699619 ATAATCCCAATAAATTTAAAAGG + Intronic
1020410662 7:7888331-7888353 TTAATGCCAATTAAGTTACATGG + Intronic
1020449574 7:8305977-8305999 AGAATTCCAGGTATTCTACAGGG + Intergenic
1020484731 7:8707197-8707219 ATAATTACAAGGAATTTATTTGG + Intronic
1020795170 7:12669800-12669822 ATGATTCTAAGTAAGTTAAAAGG - Intergenic
1021812077 7:24412367-24412389 AGAATTCCAAGTTATTTATGTGG + Intergenic
1023426958 7:40047093-40047115 ATTATTCCAAGTAATGTGAATGG + Intronic
1023720075 7:43084084-43084106 ATCCTTCCAAGTATTTTAGAAGG - Intergenic
1024358255 7:48440813-48440835 TTATTTCCAAATTATTTACATGG - Intronic
1024376185 7:48641443-48641465 ATTGTTCCAAGTAATTTGCAAGG + Intronic
1028386396 7:90258907-90258929 ATTATTTCTATTAATTTACATGG + Intronic
1028735440 7:94206685-94206707 TTAATTGCAAGAAATATACAGGG - Intergenic
1028840654 7:95426438-95426460 ATAATGCTACCTAATTTACAGGG - Intronic
1030261824 7:107573521-107573543 AAAATTAAAAGCAATTTACACGG - Intronic
1030318308 7:108138823-108138845 TAAATTCCAAGTATTATACAAGG - Intergenic
1030847204 7:114434828-114434850 AAAATTACAATTAATTTCCAAGG - Intronic
1031267683 7:119601925-119601947 ATTATTCCAAATAATTGAAAAGG - Intergenic
1031305956 7:120127955-120127977 ATAATTGCAAGTAATTTTGTAGG + Intergenic
1031439881 7:121780965-121780987 AAAATTCCAACTAATTTTTATGG + Intergenic
1031946389 7:127845918-127845940 ATAATTTAAAATACTTTACAGGG + Intronic
1035738895 8:1910720-1910742 ATGTTTCCAAATAATTTAAAAGG - Intronic
1036744352 8:11393441-11393463 ATCATTCCAAGAAGTTCACAAGG + Intronic
1039128248 8:34229539-34229561 ATGTTTCCAAGTAAGTCACATGG + Intergenic
1040613872 8:49015037-49015059 ACTATTCCAAGTAATTGAAAAGG - Intergenic
1040886569 8:52269728-52269750 ATAATTCCCAGTGATTTCTAAGG - Intronic
1043346015 8:79298550-79298572 ATAATACAAAATAATTTCCAAGG + Intergenic
1043860756 8:85314069-85314091 ATAATTGTACGTAATTCACAGGG + Intergenic
1044880831 8:96720528-96720550 TTAAGTCCTAGTAATTTATAGGG - Intronic
1046041020 8:108904982-108905004 ATATTTCCAGGTAATTTAAGAGG - Intergenic
1046101901 8:109624248-109624270 ATAATTTCCAGTGATTTCCAGGG - Intronic
1046900452 8:119518254-119518276 ATAAATCCAAAGAATGTACAGGG - Intergenic
1047462257 8:125077741-125077763 ATAATGCCATCTACTTTACAGGG + Intronic
1048561971 8:135549047-135549069 ATAATGCCCAGTAATTTACAAGG - Intronic
1048598567 8:135893634-135893656 ATAACTGCAAGCTATTTACATGG - Intergenic
1049960443 9:733381-733403 ATATTTCCAAGTGTTTCACATGG + Intronic
1050009398 9:1170767-1170789 AAAATTGCAAGTAATTTTGAAGG - Intergenic
1050611320 9:7356819-7356841 ATGTTTCCAAGTAATTTATCTGG + Intergenic
1050750180 9:8928060-8928082 ATAATTTTAACAAATTTACAAGG - Intronic
1050927420 9:11282131-11282153 ATAATTTCAAAAACTTTACATGG - Intergenic
1050967053 9:11818395-11818417 ACAATTAGAAGTAATTTATAAGG - Intergenic
1051443465 9:17113948-17113970 ATCATTCCTAGTAAATTATAGGG + Intergenic
1052869239 9:33487062-33487084 AAAATTCCAATTAATGTAGAAGG + Intergenic
1055207977 9:73756230-73756252 AGAATTACAAATAATTTTCAAGG - Intergenic
1057968193 9:99525442-99525464 ATGATTCCAAATAAGTTAAAGGG + Intergenic
1058163948 9:101599486-101599508 ATGATTCTTAGTAATTTCCATGG + Intronic
1058259333 9:102810174-102810196 ATAATTCCAACTAAAATTCATGG - Intergenic
1058474700 9:105320197-105320219 ATATTTCTCAGTAATTTAAAAGG - Intronic
1058515302 9:105766261-105766283 ATAATACCAAATAATTAACAAGG - Intronic
1059749744 9:117236791-117236813 ATAATTCTATGTAATTCATAGGG + Intronic
1059862393 9:118479290-118479312 AAAATTCCAAGTAAAGTATAAGG - Intergenic
1061522852 9:131131341-131131363 ATTATTTCAAGAAATTCACAGGG - Intronic
1185946306 X:4380348-4380370 ATAATACAAAATAATGTACAAGG - Intergenic
1186552281 X:10518947-10518969 ATAAATTGAAGAAATTTACAGGG - Intronic
1186745621 X:12565217-12565239 AAAATTCCAAATAATTTATGTGG + Intronic
1187072614 X:15903004-15903026 GTAAATCAGAGTAATTTACAAGG - Intergenic
1187704924 X:22000303-22000325 AGAATTCAAACAAATTTACAAGG - Intergenic
1188029840 X:25252086-25252108 ATAACTCCATGTACTTTGCATGG - Intergenic
1188929851 X:36094486-36094508 ATAATTCCAATTCATGAACATGG + Intronic
1189643735 X:43103677-43103699 ACAATTTCAAGTATTTAACATGG + Intergenic
1189697738 X:43682613-43682635 AGAATTCCAAATAATTTATATGG + Intronic
1191064397 X:56331907-56331929 ATATTTCCAAGAAATTTGGAGGG - Intergenic
1191866362 X:65706905-65706927 ATAATTACAAGTAACTTGCCTGG - Intronic
1192126979 X:68510382-68510404 ATGATTGCAAGTCATTTATATGG + Intronic
1192387803 X:70690789-70690811 ATAATTACAAATAATGTAAATGG + Intronic
1192490303 X:71570606-71570628 ACTATTCTAAGTACTTTACATGG - Intronic
1192676860 X:73206030-73206052 ATAATTCCAACTAATTTATGTGG + Intergenic
1193242427 X:79186734-79186756 ATACTTCCAATTAATTTCCCAGG - Intergenic
1195247912 X:103013052-103013074 TTATTTCCAAGTAACTTACTTGG + Intergenic
1196018153 X:110961291-110961313 AGATTTCCAAGCAATTTACAGGG - Intronic
1196242163 X:113354347-113354369 ACAATTCCAAGTAATGTTGAAGG + Intergenic
1197123962 X:122922927-122922949 ATGATTCCAAGCAATTGAAAAGG - Intergenic
1197434900 X:126415027-126415049 ATAATTCCAAGACATTAACCTGG - Intergenic
1197585055 X:128336590-128336612 ACATTTCCAATTAATTTCCAAGG + Intergenic
1199338957 X:146653056-146653078 ATTATTACAAGTAATTGAAAAGG + Intergenic
1200935650 Y:8736004-8736026 CTAATTCAAGGTAAATTACAGGG + Intergenic
1201273642 Y:12279291-12279313 CTAATTTCAAGTGAATTACAAGG - Intergenic