ID: 1071615187

View in Genome Browser
Species Human (GRCh38)
Location 10:87069054-87069076
Sequence ATGAACATACATATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071615185_1071615187 1 Left 1071615185 10:87069030-87069052 CCATGTAAATTACTTGGAATTAT 0: 1
1: 2
2: 2
3: 31
4: 371
Right 1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG No data
1071615183_1071615187 24 Left 1071615183 10:87069007-87069029 CCATTAAAAAGGGTAACTTATAT 0: 1
1: 0
2: 2
3: 32
4: 363
Right 1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071615187 Original CRISPR ATGAACATACATATGGAAAA AGG Intronic
No off target data available for this crispr