ID: 1071618128

View in Genome Browser
Species Human (GRCh38)
Location 10:87094822-87094844
Sequence CAGACTCCCCGCGACTAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071618123_1071618128 27 Left 1071618123 10:87094772-87094794 CCACAAGCGGAGGGGAGGTGCGT 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1071618128 10:87094822-87094844 CAGACTCCCCGCGACTAGGGAGG 0: 1
1: 1
2: 0
3: 3
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071618128 Original CRISPR CAGACTCCCCGCGACTAGGG AGG Exonic
900246589 1:1639060-1639082 TATACTCCCAGCTACTAGGGAGG - Intronic
900257814 1:1706192-1706214 TATACTCCCAGCTACTAGGGAGG - Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
904139658 1:28342603-28342625 CAGGCTCCCAGCTACTCGGGAGG - Intergenic
905975533 1:42171197-42171219 CAGACTCCCTGGGATGAGGGAGG + Intergenic
906289385 1:44610066-44610088 CAGGCACTCCGCGACTGGGGCGG + Intronic
908758714 1:67492491-67492513 CATAGTCCCAGCTACTAGGGAGG + Intergenic
911032752 1:93507768-93507790 TATAATCCCCGCTACTAGGGAGG - Intronic
914782028 1:150794003-150794025 CATAGTCCCAGCTACTAGGGAGG - Intergenic
914787255 1:150845484-150845506 CATATTCCCAGCTACTAGGGAGG + Intronic
917355190 1:174120054-174120076 CATAATCCCAGCTACTAGGGAGG - Intergenic
921435898 1:215121401-215121423 CATAATCCCAGCTACTAGGGAGG - Intronic
922511656 1:226173148-226173170 CACAGTCCCAGCTACTAGGGTGG + Intronic
923321231 1:232835631-232835653 CATAGTCCCAGCTACTAGGGAGG - Intergenic
923648184 1:235845626-235845648 CAGACTCCCGGCAGTTAGGGGGG + Intronic
923753339 1:236767422-236767444 CATACTCCCAGCTACTCGGGAGG + Intergenic
1062976449 10:1687146-1687168 CTGAATCCCAGCTACTAGGGAGG - Intronic
1063254453 10:4310877-4310899 CGTAATCCCAGCGACTAGGGAGG - Intergenic
1064805230 10:19122845-19122867 CATAATCCCAGCTACTAGGGAGG - Intronic
1066284479 10:33951217-33951239 CACACTCCCAGCTACTTGGGAGG - Intergenic
1069736633 10:70660415-70660437 TATACTCCCAGCTACTAGGGAGG - Intergenic
1070732291 10:78839142-78839164 CAATCTCCCAGCGACTTGGGAGG + Intergenic
1071097975 10:82001379-82001401 CATAATCCCCGCTACTTGGGAGG + Intronic
1071618128 10:87094822-87094844 CAGACTCCCCGCGACTAGGGAGG + Exonic
1072592980 10:96844270-96844292 CATAGTCCCAGCTACTAGGGAGG - Intronic
1072651423 10:97298834-97298856 CATAGTCCCAGCTACTAGGGAGG - Intergenic
1079356211 11:19732135-19732157 CAGTCTCCCTGCTACTCGGGAGG + Intronic
1080528967 11:33155240-33155262 TATAGTCCCCGCTACTAGGGAGG + Intronic
1084051028 11:66599996-66600018 CATAATCCCAGCTACTAGGGAGG + Intronic
1087816112 11:102660977-102660999 CGTACTCCCAGCTACTAGGGAGG - Intergenic
1087854411 11:103074525-103074547 CATAGTCCCAGCTACTAGGGAGG - Intronic
1088328581 11:108627235-108627257 TATAATCCCCGAGACTAGGGAGG + Intergenic
1089176813 11:116554671-116554693 CAGCATCCCCTCCACTAGGGAGG + Intergenic
1091471850 12:735523-735545 CTGAGTCCCAGCTACTAGGGAGG + Intergenic
1092133463 12:6128915-6128937 CATAGTCCCAGCTACTAGGGAGG - Intergenic
1092838836 12:12518389-12518411 CAGAATCCCAGCTACTTGGGAGG + Intronic
1092938900 12:13389379-13389401 CATAATCCCAGCTACTAGGGAGG + Intergenic
1094542905 12:31377267-31377289 CATAATCCCAGCTACTAGGGGGG + Intergenic
1095408971 12:41901427-41901449 TATAATCCCAGCGACTAGGGAGG + Intergenic
1099148066 12:79073221-79073243 CATAGTCCCAGCTACTAGGGAGG - Intronic
1100809626 12:98325313-98325335 CAGAGGCCCTGCTACTAGGGAGG + Intergenic
1101141525 12:101800654-101800676 CATAATCCCAGCTACTAGGGAGG + Intronic
1103079562 12:118012757-118012779 CACATTCCCAGCTACTAGGGAGG + Intergenic
1103525232 12:121563191-121563213 CATAGTCCCAGCTACTAGGGAGG + Intronic
1105467253 13:20656978-20657000 TAGAGTCCCAGCTACTAGGGAGG - Intronic
1106810088 13:33350477-33350499 CAGACTCCCGGCGACTGGAAAGG + Intronic
1107830795 13:44373005-44373027 CAGACCCCTCGGGACAAGGGTGG + Intergenic
1111775883 13:92661171-92661193 TACACTCCCAGCTACTAGGGAGG + Intronic
1112191125 13:97178773-97178795 CATAGTCCCAGCGACTGGGGAGG + Intergenic
1112754141 13:102611551-102611573 CTGAATCCCAGCTACTAGGGAGG + Intronic
1115710911 14:36049822-36049844 CATAGTCCCAGCTACTAGGGAGG + Intergenic
1116661139 14:47711600-47711622 CAGGCTCCCAGCTACTTGGGAGG + Intergenic
1116828863 14:49698323-49698345 TATACTCCCAGCTACTAGGGAGG - Intronic
1122573384 14:102724451-102724473 CATAATCCCAGCTACTAGGGAGG - Intronic
1122729857 14:103787989-103788011 CATAGTCCCAGCGACTAGAGAGG + Intronic
1202933236 14_KI270725v1_random:59180-59202 AATACTCCCAGCTACTAGGGAGG + Intergenic
1123765811 15:23477580-23477602 CAGGCTCCCCCCGACTATGAAGG - Intergenic
1125050686 15:35295034-35295056 CAGCCTCCCTGCGAGCAGGGTGG - Intronic
1125498885 15:40224674-40224696 GAGACTCCCAGCTACTTGGGAGG - Intergenic
1130119228 15:81032666-81032688 CATAGTCCCCGCTACTTGGGAGG + Intronic
1132507561 16:319214-319236 TAGAATCCCAGCGACTTGGGAGG + Intronic
1132965034 16:2648371-2648393 CATAATCCCAGCTACTAGGGAGG + Intergenic
1135006800 16:18831632-18831654 CATAGTCCCAGCTACTAGGGAGG + Intronic
1136489286 16:30595495-30595517 CATAATCCCAGCTACTAGGGAGG - Intergenic
1137354803 16:47750823-47750845 CAGAGTCCCAGCTACTTGGGAGG + Intergenic
1137815520 16:51394332-51394354 CATATTCCCAGCTACTAGGGAGG + Intergenic
1139324196 16:66139335-66139357 CATAATCCCAGCTACTAGGGAGG - Intergenic
1141092256 16:81138261-81138283 CATAATCCCAGCTACTAGGGAGG - Intergenic
1142323995 16:89402558-89402580 CAGAGTCCCAGCTACTCGGGAGG + Intronic
1145034651 17:19532762-19532784 CATAATCCCAGCTACTAGGGAGG - Intronic
1146049224 17:29535730-29535752 TATAGTCCCAGCGACTAGGGAGG + Intronic
1148855339 17:50576037-50576059 CAGACTCTGCGCCACCAGGGGGG - Exonic
1148873304 17:50671602-50671624 CAGACTCCCCGCCAACAAGGAGG - Intronic
1149338998 17:55667150-55667172 CAGCCTCCCAGCTACTTGGGAGG + Intergenic
1149631250 17:58126229-58126251 CAGCCTCCCAGTGACTTGGGAGG - Intergenic
1149826776 17:59835610-59835632 CAGAATCCCCACTACTAGTGAGG - Intronic
1150096044 17:62376340-62376362 CACACTCCCAGCTACTTGGGAGG + Intronic
1150111388 17:62503537-62503559 CATAATCCCAGCAACTAGGGTGG - Intronic
1151217242 17:72585441-72585463 CATAATCCCAGCTACTAGGGAGG + Intergenic
1151929087 17:77219751-77219773 TATAGTCCCAGCGACTAGGGAGG - Intergenic
1152187764 17:78868897-78868919 CAGAGACCCCGCGACTGGAGCGG + Intronic
1152563644 17:81090733-81090755 CAGCCTCCCCGCAGCTCGGGGGG - Intronic
1152881668 17:82820098-82820120 CTGACTCCCAGCTACTCGGGAGG - Intronic
1155015651 18:21836130-21836152 CATACTCCCAGCTACTCGGGAGG + Intronic
1155615706 18:27718858-27718880 CATAATCCCAGCGACTCGGGAGG + Intergenic
1160046695 18:75393006-75393028 AAGACTCCCAGCGTCAAGGGAGG + Intergenic
1160368281 18:78348604-78348626 CAGAGTCCCAGCTACTCGGGAGG - Intergenic
1160510184 18:79449041-79449063 CAGACCCCCCGGGACTGGGAGGG - Intronic
1161326590 19:3667248-3667270 CAGCTTCTCCGCGAGTAGGGAGG + Intronic
1162353826 19:10167999-10168021 CATACTCCCAGCTACTCGGGAGG + Intronic
1163027767 19:14523082-14523104 CATACTCCCAGCTACTCGGGAGG + Intronic
1165227298 19:34364143-34364165 CAGAGTCCCAGCTACTCGGGAGG - Intronic
1165818279 19:38657095-38657117 CATAATCCCAGCTACTAGGGAGG - Intronic
1167471032 19:49676671-49676693 CAGACTCCCCCCGGGTTGGGAGG + Intronic
1168358269 19:55716378-55716400 CATACTCCCAGCTACTCGGGAGG - Intronic
1168685397 19:58346596-58346618 CAGGCTCCCAGCTACTTGGGAGG + Intronic
927185779 2:20481364-20481386 CAGAATCCCAGCTACTTGGGAGG + Intergenic
927417424 2:22893425-22893447 CAGAGTCCCAGCTACTGGGGAGG + Intergenic
927739319 2:25553207-25553229 CATACTCCCAGCTACTCGGGAGG - Intronic
928029310 2:27765338-27765360 CATACTCCCAGCTACTCGGGAGG - Intergenic
929518695 2:42627683-42627705 CATACTCCCAGCTACTTGGGAGG - Intronic
931765141 2:65448788-65448810 CACACACCCAGCTACTAGGGAGG - Intergenic
932016001 2:68026889-68026911 CATAATCCCAGCTACTAGGGAGG + Intergenic
933806750 2:86003715-86003737 CAAAATCCCAGCTACTAGGGAGG + Intergenic
938987060 2:136587024-136587046 CAGCCTCCCAGCTACTTGGGAGG - Intergenic
939875846 2:147576922-147576944 CACAATCCCAGCGACTCGGGAGG - Intergenic
944098646 2:195997394-195997416 CAGCCTCCCCGCGAGTAGCTGGG - Intronic
945244972 2:207709986-207710008 CATAGTCCCAGCTACTAGGGAGG - Intergenic
947126838 2:226878112-226878134 CAGTCTTCCCGTGACTAGAGAGG - Intronic
948553869 2:238794246-238794268 CAGAATCCCCGGGAGGAGGGGGG + Intergenic
1168976513 20:1970018-1970040 CAGGCTCCCAGCTACTTGGGAGG - Intergenic
1169202418 20:3718340-3718362 CAGCCTCCCAGCTACTCGGGAGG - Intergenic
1169442726 20:5646406-5646428 CAGCCTCCCAGCTACTCGGGAGG - Intergenic
1169477899 20:5949237-5949259 CAGAGTCCCAGCCACTAGGGAGG + Intronic
1175691287 20:61067664-61067686 CAGACTCCAGGAGACCAGGGTGG - Intergenic
1175793579 20:61757527-61757549 CAGACTCCCCAGGACCAGGCAGG + Intronic
1176594638 21:8681351-8681373 AATACTCCCAGCTACTAGGGAGG + Intergenic
1180217396 21:46334081-46334103 CATAGTCCCAGCTACTAGGGAGG + Intronic
1180277490 22:10658480-10658502 AATACTCCCAGCTACTAGGGAGG + Intergenic
1180990747 22:19934257-19934279 CACAGTCCCAGCTACTAGGGAGG + Intronic
1181790354 22:25260823-25260845 CAGCCTCCCAGCCACTCGGGAGG - Intergenic
1181826165 22:25517835-25517857 CAGCCTCCCAGCCACTCGGGAGG - Intergenic
1183152436 22:36048416-36048438 CGTACTCCCAGCTACTAGGGAGG - Intergenic
1184054475 22:42035253-42035275 CTGACTTCCCGCAACAAGGGGGG + Intronic
1184348470 22:43927368-43927390 CATAGTCCCAGCTACTAGGGAGG + Intronic
1184707228 22:46223036-46223058 TATAGTCCCCGCGACTTGGGAGG + Intronic
951826411 3:26874012-26874034 CATAATCCCAGCTACTAGGGAGG + Intergenic
953731816 3:45456459-45456481 TAGAGTCCCCGCTACTCGGGAGG + Intronic
954238235 3:49273549-49273571 CATAATCCCAGCTACTAGGGAGG - Intronic
954749414 3:52805244-52805266 CAAACTCCCTGCCACTAGGCAGG + Intronic
955298695 3:57756879-57756901 GAGCGTCCCCGCGACCAGGGCGG - Exonic
956161350 3:66356748-66356770 CTGAGTCCCAGCTACTAGGGAGG - Intronic
959056365 3:101571695-101571717 CATAATCCCAGCTACTAGGGAGG - Intergenic
959064778 3:101645261-101645283 CATAATCCCAGCTACTAGGGAGG - Intergenic
961264838 3:125633581-125633603 CATAGTCCCAGCTACTAGGGAGG - Intergenic
963799294 3:149660038-149660060 CAGAATCCCAGCTACTCGGGAGG - Intronic
967869295 3:194216595-194216617 TATACTCCCAGCTACTAGGGAGG + Intergenic
967952335 3:194851049-194851071 CAGAATCCCAGCTACTCGGGAGG - Intergenic
971888389 4:32483337-32483359 TAGAGTCCCAGCTACTAGGGAGG - Intergenic
972691166 4:41399801-41399823 CACACTCCCAGCTACTCGGGAGG - Intronic
974716540 4:65675559-65675581 TGGACTCCCGGCTACTAGGGAGG - Intergenic
976102954 4:81584851-81584873 CAGCCTCCCAGCTACTAGGGAGG - Intronic
978427975 4:108602191-108602213 CAGAGTCCCAGCTACTGGGGAGG + Intergenic
978861939 4:113460805-113460827 AATACTCCCAGCTACTAGGGAGG - Intronic
980729901 4:136811977-136811999 CAGACACCCCGAGCCTACGGGGG + Intergenic
983487632 4:168350691-168350713 CAGCCTCCCAGCCACTTGGGAGG + Intergenic
985047315 4:185953190-185953212 CTGAATCCCAGCTACTAGGGAGG + Intronic
986727390 5:10609428-10609450 CATAGTCCCAGCTACTAGGGAGG + Intronic
990415899 5:55586454-55586476 CATACTCCCAGCTACTTGGGAGG - Intergenic
993095928 5:83478062-83478084 CATAATCCCAGCTACTAGGGAGG - Intronic
995245167 5:109927207-109927229 CATAGTCCCAGCTACTAGGGAGG + Intergenic
996251983 5:121346754-121346776 CATAATCCCAGCTACTAGGGAGG + Intergenic
999295236 5:150455395-150455417 CATACTCCCAGCTACTCGGGAGG + Intergenic
1002198298 5:177512961-177512983 CAGAGTCCCCAGGACCAGGGAGG - Intronic
1004950975 6:20671858-20671880 TAGAGTCCCAGCTACTAGGGAGG - Intronic
1005374881 6:25172166-25172188 CATAGTCCCAGCTACTAGGGAGG + Intergenic
1006311516 6:33264395-33264417 CTGACCCCCAGCGCCTAGGGGGG - Exonic
1006395059 6:33781864-33781886 CTGACTCCCCGAGAGCAGGGAGG + Intronic
1008514262 6:52304587-52304609 CATAATCCCAGCTACTAGGGAGG + Intergenic
1008779210 6:55082017-55082039 CATACTCTCAGCTACTAGGGAGG - Intergenic
1011752020 6:90463132-90463154 CTGAATCCCAGCTACTAGGGAGG + Intergenic
1016473997 6:144406486-144406508 CATAATCCCAGCTACTAGGGAGG - Intronic
1019507740 7:1401301-1401323 CAGCCTCCCAGCTACTCGGGAGG + Intergenic
1020474061 7:8574368-8574390 CAGAGTCCCAGCTACTTGGGAGG - Intronic
1021563842 7:21997207-21997229 CAGAGTCCCAGCTACTTGGGAGG - Intergenic
1021841184 7:24723090-24723112 CAGAATCCCAGTGACTTGGGTGG - Intronic
1024425428 7:49220082-49220104 CAGTCTCCCTGAGGCTAGGGAGG + Intergenic
1032040589 7:128557439-128557461 CATAATCCCAGCAACTAGGGTGG - Intergenic
1034650153 7:152683818-152683840 CATAATCCCAGCTACTAGGGAGG + Intergenic
1039803329 8:40978644-40978666 CAGAATCCCAGCTACTTGGGAGG - Intergenic
1039857266 8:41426299-41426321 CAGAGTCCCAGCTACTTGGGAGG + Intergenic
1040414632 8:47185292-47185314 CAGACACCCAGCTACTTGGGAGG - Intergenic
1041324506 8:56650688-56650710 CAGAATCCCAGCTACTCGGGAGG + Intergenic
1046609598 8:116409251-116409273 CAGAGTCCCAGCTACTCGGGAGG + Intergenic
1046950853 8:120018455-120018477 CACAATCCCAGCTACTAGGGAGG + Intronic
1049821813 8:144639202-144639224 CTGAGTCCCCGCTACTTGGGAGG + Intergenic
1050409642 9:5349714-5349736 CTGAGTCCCAGCTACTAGGGAGG - Intergenic
1057589349 9:96358863-96358885 CAGAATCCCAGCTACTTGGGAGG + Intronic
1058974506 9:110113643-110113665 CATACTCCCAGCTACTTGGGAGG - Intronic
1060852365 9:126888446-126888468 CACACTCCCAGCTACTTGGGAGG - Intergenic
1196965176 X:121047610-121047632 CAGACTCCCCGCGACTAGGAAGG - Exonic
1201312625 Y:12610613-12610635 CATAGTCCCAGCGACTTGGGAGG + Intergenic
1201323670 Y:12730594-12730616 CACACTCCCAGCTACTTGGGAGG - Intronic
1201448148 Y:14080877-14080899 CATAGTCCCAGCTACTAGGGAGG - Intergenic