ID: 1071621330

View in Genome Browser
Species Human (GRCh38)
Location 10:87122497-87122519
Sequence GTGGAAAGGAGGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071621324_1071621330 9 Left 1071621324 10:87122465-87122487 CCATGGTTTTTAGTTTCTGTCTG 0: 4
1: 66
2: 70
3: 61
4: 495
Right 1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG No data
1071621323_1071621330 16 Left 1071621323 10:87122458-87122480 CCTGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071621330 Original CRISPR GTGGAAAGGAGGGATGAGGA AGG Intronic
No off target data available for this crispr