ID: 1071625276

View in Genome Browser
Species Human (GRCh38)
Location 10:87162395-87162417
Sequence AAACCCTGAGTGACAAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071625274_1071625276 -2 Left 1071625274 10:87162374-87162396 CCTAATATATAAAGAACTTTTAA 0: 3
1: 12
2: 74
3: 246
4: 1404
Right 1071625276 10:87162395-87162417 AAACCCTGAGTGACAAAGGCTGG No data
1071625273_1071625276 -1 Left 1071625273 10:87162373-87162395 CCCTAATATATAAAGAACTTTTA 0: 6
1: 44
2: 459
3: 1588
4: 3753
Right 1071625276 10:87162395-87162417 AAACCCTGAGTGACAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071625276 Original CRISPR AAACCCTGAGTGACAAAGGC TGG Intronic
No off target data available for this crispr