ID: 1071626806

View in Genome Browser
Species Human (GRCh38)
Location 10:87180185-87180207
Sequence CAACCAGTATATACGATGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071626806_1071626810 17 Left 1071626806 10:87180185-87180207 CCCAACATCGTATATACTGGTTG 0: 1
1: 0
2: 4
3: 2
4: 81
Right 1071626810 10:87180225-87180247 AACTAGAAACAGATGAGAACAGG 0: 3
1: 1
2: 1
3: 29
4: 325
1071626806_1071626809 -6 Left 1071626806 10:87180185-87180207 CCCAACATCGTATATACTGGTTG 0: 1
1: 0
2: 4
3: 2
4: 81
Right 1071626809 10:87180202-87180224 TGGTTGTGCAAAATGTGGATTGG 0: 1
1: 2
2: 3
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071626806 Original CRISPR CAACCAGTATATACGATGTT GGG (reversed) Exonic
901169888 1:7249207-7249229 TAATCAGGATATACGATGTGGGG - Intronic
909405096 1:75279984-75280006 AAGCGAGAATATACGATGTTTGG + Intronic
909721735 1:78778812-78778834 AAATAAGTATATACCATGTTGGG - Intergenic
910019824 1:82573588-82573610 CATACAGTATATACTATTTTGGG - Intergenic
915994717 1:160550793-160550815 CAACCAGGAAATACCATGTCAGG - Intronic
919105071 1:193139629-193139651 TAAAAAGTATATATGATGTTTGG - Intronic
921317595 1:213906667-213906689 CAACAAGTATTTGTGATGTTGGG - Intergenic
923662238 1:235968402-235968424 CAGTAAGAATATACGATGTTTGG - Intergenic
924901837 1:248409218-248409240 CAACCAACATATAAGATGTATGG - Intergenic
1067483369 10:46621702-46621724 CAGCCAGTATATATGATGTTGGG + Intergenic
1067611388 10:47719943-47719965 CAGCCAGTATATATGATGTTGGG - Intergenic
1071626806 10:87180185-87180207 CAACCAGTATATACGATGTTGGG - Exonic
1078314002 11:10276824-10276846 CAACCAGTAGATACTTTCTTGGG - Intronic
1083703335 11:64495706-64495728 CAGTGAGAATATACGATGTTTGG + Intergenic
1093916238 12:24805355-24805377 CATCCAGTAGATGCAATGTTGGG + Intergenic
1094399272 12:30044029-30044051 CATCTAGTAGTTACGATGTTAGG + Intergenic
1096348498 12:50873095-50873117 CAGCGAGAATATATGATGTTTGG - Intronic
1103247897 12:119473688-119473710 GAATGAGAATATACGATGTTTGG + Intronic
1104147240 12:126046996-126047018 CAATGAGAACATACGATGTTTGG - Intergenic
1105745199 13:23371038-23371060 CCAGAAGTATATACCATGTTGGG - Intronic
1106424994 13:29619424-29619446 GAATGAGAATATACGATGTTTGG - Intergenic
1107445097 13:40463431-40463453 CAGCGAGAATATAAGATGTTTGG + Intergenic
1108272349 13:48773927-48773949 AAGACAATATATACGATGTTAGG + Intergenic
1108288522 13:48933293-48933315 CAATGAGAACATACGATGTTTGG + Intergenic
1109503447 13:63268028-63268050 CAGCTAGAACATACGATGTTTGG + Intergenic
1116601086 14:46923861-46923883 CAACCAGTAGATGTCATGTTTGG - Intronic
1117594457 14:57311853-57311875 CAAACAGCATATAGGATTTTTGG + Intergenic
1118704704 14:68470190-68470212 CAACCAGTAAATAAAATGCTTGG + Intronic
1120726974 14:87954769-87954791 CAGCCAGTATATATGATGTTGGG - Intronic
1121556678 14:94843311-94843333 CAACCAGTATAACAGAGGTTAGG + Intergenic
1125250769 15:37700375-37700397 AAAACAGTATATAGGATCTTCGG + Intergenic
1127448972 15:59098356-59098378 TAAGAAGTATATACAATGTTGGG + Intergenic
1130951111 15:88589363-88589385 CAGTGAGAATATACGATGTTTGG - Intergenic
1137973418 16:53008756-53008778 CAATGAGAACATACGATGTTTGG - Intergenic
1159298288 18:66524979-66525001 GAACCAGTATATACTTTCTTAGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1164764022 19:30749436-30749458 CCACCAGTCTTCACGATGTTTGG + Intergenic
1166649853 19:44564252-44564274 CAATGAGGACATACGATGTTTGG - Intergenic
1167187827 19:47958860-47958882 CAGTGAGAATATACGATGTTTGG + Intergenic
925463435 2:4085165-4085187 CAAACAGTAGATACAATGTATGG + Intergenic
926560654 2:14413925-14413947 CAGTGAGAATATACGATGTTCGG - Intergenic
928692138 2:33811007-33811029 CAAACAGTAAATACAATGTTTGG + Intergenic
932897950 2:75661934-75661956 TCACCATTATATATGATGTTAGG + Intronic
939760844 2:146176523-146176545 GAACCAGTATATATGCTTTTTGG - Intergenic
942113823 2:172707931-172707953 CAACCAGTATATAAGAACTGTGG + Intergenic
943752653 2:191525848-191525870 CAGCAAGAAGATACGATGTTTGG - Intergenic
948547674 2:238744304-238744326 CAATGAGAACATACGATGTTTGG + Intergenic
1169587853 20:7106392-7106414 CAGTGAGAATATACGATGTTTGG + Intergenic
1171081022 20:22184840-22184862 CAGCGAGAACATACGATGTTTGG + Intergenic
1173830890 20:46087458-46087480 CAACCAGAATAAACAATTTTTGG - Intronic
1178612630 21:34097949-34097971 CCACCAGTATATGGAATGTTAGG + Exonic
951925187 3:27901578-27901600 CAAACAGAATATGAGATGTTGGG - Intergenic
956950737 3:74279548-74279570 CAATGAGAACATACGATGTTTGG - Intronic
958606722 3:96367381-96367403 GAATGAGAATATACGATGTTTGG + Intergenic
959325186 3:104927991-104928013 CAGTGAGAATATACGATGTTTGG + Intergenic
966068469 3:175845140-175845162 CAATCAATAAAAACGATGTTTGG + Intergenic
971900397 4:32650772-32650794 CAACAAGTATCTAAGAAGTTTGG + Intergenic
972967563 4:44530283-44530305 CATCCAGTATATAGTATTTTTGG - Intergenic
974373058 4:61042461-61042483 AAACCAGTATCTACCAAGTTGGG + Intergenic
975974822 4:80082626-80082648 AAACAAGTATATACAAGGTTTGG - Intronic
977237229 4:94523172-94523194 CACCCAGTATAAAAGATATTTGG + Intronic
978404138 4:108362010-108362032 CAATCAGTATATAAGAGGTTGGG + Intergenic
979460566 4:120978175-120978197 CAGTGAGAATATACGATGTTTGG - Intergenic
979497927 4:121405538-121405560 CAGTGAGAATATACGATGTTTGG + Intergenic
980606357 4:135095641-135095663 CAACAAGTATATAAAGTGTTTGG - Intergenic
981461880 4:145022422-145022444 CAGTGAGAATATACGATGTTTGG - Intronic
984345703 4:178521934-178521956 CAGTGAGAATATACGATGTTTGG + Intergenic
993553840 5:89310269-89310291 CAATGAGAATATACAATGTTTGG + Intergenic
997954755 5:138270469-138270491 CAGTGAGAATATACGATGTTTGG - Intronic
1001089375 5:168726267-168726289 TCACCAGTATATACGATACTTGG - Intronic
1004509443 6:16273362-16273384 CAGCCAGTATATAGGATACTTGG - Intronic
1009475006 6:64079801-64079823 CTATCAGAATATGCGATGTTTGG + Intronic
1009543844 6:65000394-65000416 CAACCAGTATATATGATGTCTGG - Intronic
1009878654 6:69537990-69538012 CAGCGAGAACATACGATGTTTGG + Intergenic
1019264378 7:104905-104927 AAAACAGTATATACAGTGTTTGG - Intergenic
1019788060 7:2992007-2992029 GAGCCAGAACATACGATGTTTGG + Intronic
1023701799 7:42899377-42899399 CAGTGAGAATATACGATGTTTGG - Intergenic
1035947465 8:3981251-3981273 CAGTGAGTACATACGATGTTTGG - Intronic
1037077345 8:14736709-14736731 CAGTGAGAATATACGATGTTTGG + Intronic
1041112231 8:54494071-54494093 CAGTGAGAATATACGATGTTTGG + Intergenic
1045609548 8:103820793-103820815 CAAACAGTATATGAAATGTTAGG + Intronic
1046782317 8:118229042-118229064 CAGTGAGAATATACGATGTTTGG - Intronic
1050635780 9:7610932-7610954 GAACGAGAACATACGATGTTTGG + Intergenic
1052247443 9:26353231-26353253 CAGCAAGAACATACGATGTTTGG - Intergenic
1054844988 9:69785314-69785336 CAACCATTGTATACAATTTTAGG + Intergenic
1190148311 X:47918937-47918959 CACCCAATATATACAATGGTGGG - Exonic
1195627087 X:107014996-107015018 CAACCTGTATAAACTATTTTTGG - Intergenic
1196575464 X:117312992-117313014 CAGCAAGAACATACGATGTTTGG - Intergenic