ID: 1071627898

View in Genome Browser
Species Human (GRCh38)
Location 10:87191855-87191877
Sequence CCCTTCAATGATTCGTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071627894_1071627898 23 Left 1071627894 10:87191809-87191831 CCATTTTGTATCTAGAGAGACTG No data
Right 1071627898 10:87191855-87191877 CCCTTCAATGATTCGTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071627898 Original CRISPR CCCTTCAATGATTCGTTGAA TGG Intergenic
No off target data available for this crispr