ID: 1071630876

View in Genome Browser
Species Human (GRCh38)
Location 10:87217095-87217117
Sequence CTGGTGCTAAGGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071630876_1071630884 2 Left 1071630876 10:87217095-87217117 CCCTCCTCACTCCTTAGCACCAG No data
Right 1071630884 10:87217120-87217142 CTGGCTGTACATCCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071630876 Original CRISPR CTGGTGCTAAGGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr