ID: 1071631534

View in Genome Browser
Species Human (GRCh38)
Location 10:87222718-87222740
Sequence TTTCCTAGTGGGGGCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071631534_1071631541 12 Left 1071631534 10:87222718-87222740 CCCGCAGGGCCCCCACTAGGAAA No data
Right 1071631541 10:87222753-87222775 CCCGCCTTGAGCACAGCCACAGG No data
1071631534_1071631544 22 Left 1071631534 10:87222718-87222740 CCCGCAGGGCCCCCACTAGGAAA No data
Right 1071631544 10:87222763-87222785 GCACAGCCACAGGCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071631534 Original CRISPR TTTCCTAGTGGGGGCCCTGC GGG (reversed) Intergenic
No off target data available for this crispr