ID: 1071631610

View in Genome Browser
Species Human (GRCh38)
Location 10:87223059-87223081
Sequence TCTCCAGCGGGGCCCTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071631610_1071631623 17 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631623 10:87223099-87223121 GCGGCACCTGGGCGCTTCCTGGG No data
1071631610_1071631622 16 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631622 10:87223098-87223120 CGCGGCACCTGGGCGCTTCCTGG No data
1071631610_1071631617 -9 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631617 10:87223073-87223095 CGCTGGAGATGTGGAAATGGAGG No data
1071631610_1071631620 5 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631620 10:87223087-87223109 AAATGGAGGGACGCGGCACCTGG No data
1071631610_1071631624 18 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631624 10:87223100-87223122 CGGCACCTGGGCGCTTCCTGGGG No data
1071631610_1071631618 -8 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631618 10:87223074-87223096 GCTGGAGATGTGGAAATGGAGGG No data
1071631610_1071631621 6 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631621 10:87223088-87223110 AATGGAGGGACGCGGCACCTGGG No data
1071631610_1071631619 -2 Left 1071631610 10:87223059-87223081 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071631619 10:87223080-87223102 GATGTGGAAATGGAGGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071631610 Original CRISPR TCTCCAGCGGGGCCCTCCTA GGG (reversed) Intergenic
No off target data available for this crispr