ID: 1071634062

View in Genome Browser
Species Human (GRCh38)
Location 10:87235629-87235651
Sequence ATGTAGACACAGATTTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071634059_1071634062 8 Left 1071634059 10:87235598-87235620 CCCATATGATGACTGAACTCATG 0: 5
1: 2
2: 0
3: 8
4: 101
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data
1071634058_1071634062 12 Left 1071634058 10:87235594-87235616 CCTTCCCATATGATGACTGAACT 0: 7
1: 0
2: 1
3: 4
4: 117
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data
1071634060_1071634062 7 Left 1071634060 10:87235599-87235621 CCATATGATGACTGAACTCATGT 0: 5
1: 2
2: 0
3: 12
4: 189
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data
1071634055_1071634062 28 Left 1071634055 10:87235578-87235600 CCCACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data
1071634053_1071634062 30 Left 1071634053 10:87235576-87235598 CCCCCACAGCTATGATTCCCTTC 0: 5
1: 2
2: 0
3: 11
4: 160
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data
1071634057_1071634062 13 Left 1071634057 10:87235593-87235615 CCCTTCCCATATGATGACTGAAC 0: 7
1: 0
2: 0
3: 5
4: 124
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data
1071634056_1071634062 27 Left 1071634056 10:87235579-87235601 CCACAGCTATGATTCCCTTCCCA 0: 5
1: 0
2: 1
3: 19
4: 207
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data
1071634054_1071634062 29 Left 1071634054 10:87235577-87235599 CCCCACAGCTATGATTCCCTTCC 0: 5
1: 2
2: 2
3: 11
4: 202
Right 1071634062 10:87235629-87235651 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071634062 Original CRISPR ATGTAGACACAGATTTACAT TGG Intronic
No off target data available for this crispr