ID: 1071637213

View in Genome Browser
Species Human (GRCh38)
Location 10:87267589-87267611
Sequence CACAGCAAGGAGAATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071637213_1071637217 24 Left 1071637213 10:87267589-87267611 CCTGCCACATTCTCCTTGCTGTG No data
Right 1071637217 10:87267636-87267658 TACTAAAGGAACTCAGAGACCGG No data
1071637213_1071637216 10 Left 1071637213 10:87267589-87267611 CCTGCCACATTCTCCTTGCTGTG No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071637213 Original CRISPR CACAGCAAGGAGAATGTGGC AGG (reversed) Intergenic
No off target data available for this crispr