ID: 1071637216

View in Genome Browser
Species Human (GRCh38)
Location 10:87267622-87267644
Sequence TAGTAATCAATAAATACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071637214_1071637216 6 Left 1071637214 10:87267593-87267615 CCACATTCTCCTTGCTGTGATAA No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637209_1071637216 28 Left 1071637209 10:87267571-87267593 CCACTATCACCCCGTTCTCCTGC No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637207_1071637216 30 Left 1071637207 10:87267569-87267591 CCCCACTATCACCCCGTTCTCCT No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637211_1071637216 18 Left 1071637211 10:87267581-87267603 CCCGTTCTCCTGCCACATTCTCC No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637208_1071637216 29 Left 1071637208 10:87267570-87267592 CCCACTATCACCCCGTTCTCCTG No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637213_1071637216 10 Left 1071637213 10:87267589-87267611 CCTGCCACATTCTCCTTGCTGTG No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637215_1071637216 -3 Left 1071637215 10:87267602-87267624 CCTTGCTGTGATAATGAAAATAG No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637212_1071637216 17 Left 1071637212 10:87267582-87267604 CCGTTCTCCTGCCACATTCTCCT No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data
1071637210_1071637216 19 Left 1071637210 10:87267580-87267602 CCCCGTTCTCCTGCCACATTCTC No data
Right 1071637216 10:87267622-87267644 TAGTAATCAATAAATACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071637216 Original CRISPR TAGTAATCAATAAATACTAA AGG Intergenic
No off target data available for this crispr