ID: 1071637217

View in Genome Browser
Species Human (GRCh38)
Location 10:87267636-87267658
Sequence TACTAAAGGAACTCAGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071637215_1071637217 11 Left 1071637215 10:87267602-87267624 CCTTGCTGTGATAATGAAAATAG No data
Right 1071637217 10:87267636-87267658 TACTAAAGGAACTCAGAGACCGG No data
1071637214_1071637217 20 Left 1071637214 10:87267593-87267615 CCACATTCTCCTTGCTGTGATAA No data
Right 1071637217 10:87267636-87267658 TACTAAAGGAACTCAGAGACCGG No data
1071637213_1071637217 24 Left 1071637213 10:87267589-87267611 CCTGCCACATTCTCCTTGCTGTG No data
Right 1071637217 10:87267636-87267658 TACTAAAGGAACTCAGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071637217 Original CRISPR TACTAAAGGAACTCAGAGAC CGG Intergenic
No off target data available for this crispr