ID: 1071639129

View in Genome Browser
Species Human (GRCh38)
Location 10:87288266-87288288
Sequence CTGTTTCCTCAGCTGCAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071639129_1071639134 0 Left 1071639129 10:87288266-87288288 CCCAATTGCAGCTGAGGAAACAG No data
Right 1071639134 10:87288289-87288311 GGTGAGTGAGGCCAAGCAGCTGG No data
1071639129_1071639140 26 Left 1071639129 10:87288266-87288288 CCCAATTGCAGCTGAGGAAACAG No data
Right 1071639140 10:87288315-87288337 AAGGTCCCCTGCCTGGTAAGTGG No data
1071639129_1071639135 7 Left 1071639129 10:87288266-87288288 CCCAATTGCAGCTGAGGAAACAG No data
Right 1071639135 10:87288296-87288318 GAGGCCAAGCAGCTGGCCCAAGG No data
1071639129_1071639137 19 Left 1071639129 10:87288266-87288288 CCCAATTGCAGCTGAGGAAACAG No data
Right 1071639137 10:87288308-87288330 CTGGCCCAAGGTCCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071639129 Original CRISPR CTGTTTCCTCAGCTGCAATT GGG (reversed) Intergenic
No off target data available for this crispr