ID: 1071644976

View in Genome Browser
Species Human (GRCh38)
Location 10:87354930-87354952
Sequence TTTCCTAGTGGGGGCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071644976_1071644986 22 Left 1071644976 10:87354930-87354952 CCCGCAGGGCCCCCACTAGGAAA No data
Right 1071644986 10:87354975-87354997 GCACAGCCACAGGCCTGCTCTGG No data
1071644976_1071644983 12 Left 1071644976 10:87354930-87354952 CCCGCAGGGCCCCCACTAGGAAA No data
Right 1071644983 10:87354965-87354987 CCCGCCTTGAGCACAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071644976 Original CRISPR TTTCCTAGTGGGGGCCCTGC GGG (reversed) Intergenic
No off target data available for this crispr