ID: 1071645054

View in Genome Browser
Species Human (GRCh38)
Location 10:87355279-87355301
Sequence TCTCCAGCGGGGCCCTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071645054_1071645064 5 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645064 10:87355307-87355329 AAATGGAGGGACGCGGCACCTGG No data
1071645054_1071645065 6 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645065 10:87355308-87355330 AATGGAGGGACGCGGCACCTGGG No data
1071645054_1071645063 -2 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645063 10:87355300-87355322 GATGTGGAAATGGAGGGACGCGG No data
1071645054_1071645066 16 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645066 10:87355318-87355340 CGCGGCACCTGGGCGCTTCCTGG No data
1071645054_1071645062 -8 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645062 10:87355294-87355316 GCTGGAGATGTGGAAATGGAGGG No data
1071645054_1071645067 17 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645067 10:87355319-87355341 GCGGCACCTGGGCGCTTCCTGGG No data
1071645054_1071645068 18 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645068 10:87355320-87355342 CGGCACCTGGGCGCTTCCTGGGG No data
1071645054_1071645061 -9 Left 1071645054 10:87355279-87355301 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1071645061 10:87355293-87355315 CGCTGGAGATGTGGAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071645054 Original CRISPR TCTCCAGCGGGGCCCTCCTA GGG (reversed) Intergenic
No off target data available for this crispr