ID: 1071647508

View in Genome Browser
Species Human (GRCh38)
Location 10:87367846-87367868
Sequence ATGTAGACACAGATTTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071647500_1071647508 29 Left 1071647500 10:87367794-87367816 CCCCACAGCTATGATTCCCTTCC 0: 5
1: 2
2: 2
3: 11
4: 202
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data
1071647502_1071647508 27 Left 1071647502 10:87367796-87367818 CCACAGCTATGATTCCCTTCCCA 0: 5
1: 0
2: 1
3: 19
4: 207
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data
1071647504_1071647508 12 Left 1071647504 10:87367811-87367833 CCTTCCCATATGATGACTGAACT 0: 7
1: 0
2: 1
3: 4
4: 117
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data
1071647499_1071647508 30 Left 1071647499 10:87367793-87367815 CCCCCACAGCTATGATTCCCTTC 0: 5
1: 2
2: 0
3: 11
4: 160
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data
1071647506_1071647508 7 Left 1071647506 10:87367816-87367838 CCATATGATGACTGAACTCATGT 0: 5
1: 2
2: 0
3: 12
4: 189
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data
1071647505_1071647508 8 Left 1071647505 10:87367815-87367837 CCCATATGATGACTGAACTCATG 0: 5
1: 2
2: 0
3: 8
4: 101
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data
1071647501_1071647508 28 Left 1071647501 10:87367795-87367817 CCCACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data
1071647503_1071647508 13 Left 1071647503 10:87367810-87367832 CCCTTCCCATATGATGACTGAAC 0: 7
1: 0
2: 0
3: 5
4: 124
Right 1071647508 10:87367846-87367868 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071647508 Original CRISPR ATGTAGACACAGATTTACAT TGG Intronic
No off target data available for this crispr