ID: 1071649037

View in Genome Browser
Species Human (GRCh38)
Location 10:87378080-87378102
Sequence GGCAGATGCCCTTGCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071649037_1071649044 22 Left 1071649037 10:87378080-87378102 CCATCACAGCAAGGGCATCTGCC No data
Right 1071649044 10:87378125-87378147 GAGCCCTCAGCTCTTTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071649037 Original CRISPR GGCAGATGCCCTTGCTGTGA TGG (reversed) Intergenic
No off target data available for this crispr