ID: 1071649246

View in Genome Browser
Species Human (GRCh38)
Location 10:87379667-87379689
Sequence ATCAGACTTCAGGCCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071649240_1071649246 21 Left 1071649240 10:87379623-87379645 CCCTGTAGGCACCTGATCTCCTC No data
Right 1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG No data
1071649241_1071649246 20 Left 1071649241 10:87379624-87379646 CCTGTAGGCACCTGATCTCCTCC No data
Right 1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG No data
1071649242_1071649246 10 Left 1071649242 10:87379634-87379656 CCTGATCTCCTCCATTAACATTT No data
Right 1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG No data
1071649244_1071649246 -1 Left 1071649244 10:87379645-87379667 CCATTAACATTTTATTTACAAAA No data
Right 1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG No data
1071649243_1071649246 2 Left 1071649243 10:87379642-87379664 CCTCCATTAACATTTTATTTACA No data
Right 1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071649246 Original CRISPR ATCAGACTTCAGGCCAAAGC TGG Intergenic
No off target data available for this crispr