ID: 1071650810

View in Genome Browser
Species Human (GRCh38)
Location 10:87391670-87391692
Sequence GTGGACTAAACAGGAACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071650810_1071650816 -2 Left 1071650810 10:87391670-87391692 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1071650816 10:87391691-87391713 ACAGCAAAGGTGCGGCCGGTTGG No data
1071650810_1071650813 -10 Left 1071650810 10:87391670-87391692 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1071650813 10:87391683-87391705 TTTAGTCCACAGCAAAGGTGCGG No data
1071650810_1071650814 -6 Left 1071650810 10:87391670-87391692 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1071650814 10:87391687-87391709 GTCCACAGCAAAGGTGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071650810 Original CRISPR GTGGACTAAACAGGAACCAC TGG (reversed) Intergenic
No off target data available for this crispr