ID: 1071650889

View in Genome Browser
Species Human (GRCh38)
Location 10:87392133-87392155
Sequence GACCCTAGGAGGGTGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071650881_1071650889 9 Left 1071650881 10:87392101-87392123 CCTCAAAACACATGATGAGATGG No data
Right 1071650889 10:87392133-87392155 GACCCTAGGAGGGTGGGGACTGG No data
1071650880_1071650889 10 Left 1071650880 10:87392100-87392122 CCCTCAAAACACATGATGAGATG No data
Right 1071650889 10:87392133-87392155 GACCCTAGGAGGGTGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071650889 Original CRISPR GACCCTAGGAGGGTGGGGAC TGG Intergenic
No off target data available for this crispr