ID: 1071651229

View in Genome Browser
Species Human (GRCh38)
Location 10:87394727-87394749
Sequence AAACCACTGCCCTAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071651229_1071651238 19 Left 1071651229 10:87394727-87394749 CCCATCTCCTAGGGCAGTGGTTT No data
Right 1071651238 10:87394769-87394791 CAGTAGCACCTTCATCTCTTGGG No data
1071651229_1071651237 18 Left 1071651229 10:87394727-87394749 CCCATCTCCTAGGGCAGTGGTTT No data
Right 1071651237 10:87394768-87394790 CCAGTAGCACCTTCATCTCTTGG No data
1071651229_1071651240 30 Left 1071651229 10:87394727-87394749 CCCATCTCCTAGGGCAGTGGTTT No data
Right 1071651240 10:87394780-87394802 TCATCTCTTGGGAACTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071651229 Original CRISPR AAACCACTGCCCTAGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr