ID: 1071651757

View in Genome Browser
Species Human (GRCh38)
Location 10:87399045-87399067
Sequence ACTGCTCCTGCATTTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071651748_1071651757 18 Left 1071651748 10:87399004-87399026 CCTCTCTCCTCTAATGTGCAGTT No data
Right 1071651757 10:87399045-87399067 ACTGCTCCTGCATTTGGGTGGGG No data
1071651749_1071651757 11 Left 1071651749 10:87399011-87399033 CCTCTAATGTGCAGTTGTGAAGG No data
Right 1071651757 10:87399045-87399067 ACTGCTCCTGCATTTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071651757 Original CRISPR ACTGCTCCTGCATTTGGGTG GGG Intergenic
No off target data available for this crispr