ID: 1071652416

View in Genome Browser
Species Human (GRCh38)
Location 10:87405827-87405849
Sequence ATCTTAAGCTAAAAGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071652414_1071652416 -6 Left 1071652414 10:87405810-87405832 CCTGAATAGCCAAAGCAATCTTA 0: 50
1: 453
2: 2106
3: 4065
4: 7020
Right 1071652416 10:87405827-87405849 ATCTTAAGCTAAAAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071652416 Original CRISPR ATCTTAAGCTAAAAGAACAA AGG Intergenic
No off target data available for this crispr