ID: 1071656097

View in Genome Browser
Species Human (GRCh38)
Location 10:87449634-87449656
Sequence AAGGTCCCCTGCCTGGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071656097_1071656101 -8 Left 1071656097 10:87449634-87449656 CCACTTACCAGGCAGGGGACCTT No data
Right 1071656101 10:87449649-87449671 GGGACCTTGGGCCAGCTGCTTGG No data
1071656097_1071656107 25 Left 1071656097 10:87449634-87449656 CCACTTACCAGGCAGGGGACCTT No data
Right 1071656107 10:87449682-87449704 CCTGTTTCCTCAGCTGCAATTGG No data
1071656097_1071656108 26 Left 1071656097 10:87449634-87449656 CCACTTACCAGGCAGGGGACCTT No data
Right 1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071656097 Original CRISPR AAGGTCCCCTGCCTGGTAAG TGG (reversed) Intergenic
No off target data available for this crispr