ID: 1071656102

View in Genome Browser
Species Human (GRCh38)
Location 10:87449653-87449675
Sequence GAGGCCAAGCAGCTGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071656102_1071656111 30 Left 1071656102 10:87449653-87449675 CCTTGGGCCAGCTGCTTGGCCTC No data
Right 1071656111 10:87449706-87449728 ATGAACAGACTGCCTGCTTCGGG No data
1071656102_1071656108 7 Left 1071656102 10:87449653-87449675 CCTTGGGCCAGCTGCTTGGCCTC No data
Right 1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG No data
1071656102_1071656107 6 Left 1071656102 10:87449653-87449675 CCTTGGGCCAGCTGCTTGGCCTC No data
Right 1071656107 10:87449682-87449704 CCTGTTTCCTCAGCTGCAATTGG No data
1071656102_1071656110 29 Left 1071656102 10:87449653-87449675 CCTTGGGCCAGCTGCTTGGCCTC No data
Right 1071656110 10:87449705-87449727 GATGAACAGACTGCCTGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071656102 Original CRISPR GAGGCCAAGCAGCTGGCCCA AGG (reversed) Intergenic
No off target data available for this crispr