ID: 1071656103

View in Genome Browser
Species Human (GRCh38)
Location 10:87449660-87449682
Sequence GGTGAGTGAGGCCAAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071656103_1071656111 23 Left 1071656103 10:87449660-87449682 CCAGCTGCTTGGCCTCACTCACC No data
Right 1071656111 10:87449706-87449728 ATGAACAGACTGCCTGCTTCGGG No data
1071656103_1071656108 0 Left 1071656103 10:87449660-87449682 CCAGCTGCTTGGCCTCACTCACC No data
Right 1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG No data
1071656103_1071656110 22 Left 1071656103 10:87449660-87449682 CCAGCTGCTTGGCCTCACTCACC No data
Right 1071656110 10:87449705-87449727 GATGAACAGACTGCCTGCTTCGG No data
1071656103_1071656112 24 Left 1071656103 10:87449660-87449682 CCAGCTGCTTGGCCTCACTCACC No data
Right 1071656112 10:87449707-87449729 TGAACAGACTGCCTGCTTCGGGG No data
1071656103_1071656107 -1 Left 1071656103 10:87449660-87449682 CCAGCTGCTTGGCCTCACTCACC No data
Right 1071656107 10:87449682-87449704 CCTGTTTCCTCAGCTGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071656103 Original CRISPR GGTGAGTGAGGCCAAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr