ID: 1071656108

View in Genome Browser
Species Human (GRCh38)
Location 10:87449683-87449705
Sequence CTGTTTCCTCAGCTGCAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071656097_1071656108 26 Left 1071656097 10:87449634-87449656 CCACTTACCAGGCAGGGGACCTT No data
Right 1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG No data
1071656100_1071656108 19 Left 1071656100 10:87449641-87449663 CCAGGCAGGGGACCTTGGGCCAG No data
Right 1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG No data
1071656103_1071656108 0 Left 1071656103 10:87449660-87449682 CCAGCTGCTTGGCCTCACTCACC No data
Right 1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG No data
1071656102_1071656108 7 Left 1071656102 10:87449653-87449675 CCTTGGGCCAGCTGCTTGGCCTC No data
Right 1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071656108 Original CRISPR CTGTTTCCTCAGCTGCAATT GGG Intergenic
No off target data available for this crispr