ID: 1071673151

View in Genome Browser
Species Human (GRCh38)
Location 10:87630367-87630389
Sequence ATGCCCATCCAAAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071673151_1071673153 3 Left 1071673151 10:87630367-87630389 CCTTCATTCTTTTGGATGGGCAT No data
Right 1071673153 10:87630393-87630415 TTATTAGGTCTGTTTTTCCATGG No data
1071673151_1071673154 19 Left 1071673151 10:87630367-87630389 CCTTCATTCTTTTGGATGGGCAT No data
Right 1071673154 10:87630409-87630431 TCCATGGTTTAAAGTAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071673151 Original CRISPR ATGCCCATCCAAAAGAATGA AGG (reversed) Intergenic
No off target data available for this crispr