ID: 1071673925

View in Genome Browser
Species Human (GRCh38)
Location 10:87637393-87637415
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071673925_1071673928 11 Left 1071673925 10:87637393-87637415 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1071673928 10:87637427-87637449 AAGTAGTTATCTTCAGAAGATGG No data
1071673925_1071673929 15 Left 1071673925 10:87637393-87637415 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG No data
1071673925_1071673930 16 Left 1071673925 10:87637393-87637415 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1071673930 10:87637432-87637454 GTTATCTTCAGAAGATGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071673925 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr