ID: 1071673929

View in Genome Browser
Species Human (GRCh38)
Location 10:87637431-87637453
Sequence AGTTATCTTCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071673927_1071673929 4 Left 1071673927 10:87637404-87637426 CCAAAAGCTGTCTCTCAAAAGGA No data
Right 1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG No data
1071673922_1071673929 25 Left 1071673922 10:87637383-87637405 CCACCAAGGCCCAGTAACAGGCC No data
Right 1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG No data
1071673923_1071673929 22 Left 1071673923 10:87637386-87637408 CCAAGGCCCAGTAACAGGCCAAA No data
Right 1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG No data
1071673925_1071673929 15 Left 1071673925 10:87637393-87637415 CCAGTAACAGGCCAAAAGCTGTC No data
Right 1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG No data
1071673924_1071673929 16 Left 1071673924 10:87637392-87637414 CCCAGTAACAGGCCAAAAGCTGT No data
Right 1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071673929 Original CRISPR AGTTATCTTCAGAAGATGGT AGG Intergenic
No off target data available for this crispr