ID: 1071676656

View in Genome Browser
Species Human (GRCh38)
Location 10:87661170-87661192
Sequence AAGTGGGGAAGGAGTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071676648_1071676656 19 Left 1071676648 10:87661128-87661150 CCGGGGAGAGGTTTAAAAAAAAA No data
Right 1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071676656 Original CRISPR AAGTGGGGAAGGAGTGTGGA GGG Intronic
No off target data available for this crispr