ID: 1071679171

View in Genome Browser
Species Human (GRCh38)
Location 10:87687184-87687206
Sequence CTGTGGGGATAGTGGTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071679171_1071679177 -4 Left 1071679171 10:87687184-87687206 CCCTTTCACCACTATCCCCACAG 0: 1
1: 0
2: 1
3: 18
4: 299
Right 1071679177 10:87687203-87687225 ACAGCCCCAAGTACAATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071679171 Original CRISPR CTGTGGGGATAGTGGTGAAA GGG (reversed) Intronic
903288056 1:22289407-22289429 CGGTGGGGATGGTGGTGGTAGGG + Intergenic
904273077 1:29363103-29363125 CTGTGGGGATCCTGTGGAAAAGG + Intergenic
904705153 1:32384326-32384348 CTATGGGTAGAGTGGTGGAAAGG + Intronic
906682764 1:47741611-47741633 CTGGGGAGATTGTGGAGAAAAGG + Intergenic
907633928 1:56113880-56113902 CAGTGGGGATAGAGCTGAACAGG + Intergenic
907934883 1:59033128-59033150 CAGTGGGGATTGCGGTGAAATGG + Intergenic
909141269 1:71868853-71868875 TTGAGGGGAAAGTGGTGAGAGGG - Intronic
910348677 1:86270866-86270888 CTGTGGTGATAATGGTGATTTGG - Intergenic
910415394 1:86992169-86992191 GGGTGGGGGTAGTGGTGGAATGG - Intronic
910504993 1:87940275-87940297 CGGTGGAGATGGTGATGAAATGG + Intergenic
912309116 1:108601902-108601924 CTGGGAGGACAGTGGTGAACTGG + Intronic
913417748 1:118630403-118630425 ATGGGGTGATTGTGGTGAAAAGG - Intergenic
914017072 1:143829702-143829724 ATCTGGGGATAGTGGTTAACAGG - Intergenic
914160714 1:145131296-145131318 ATCTGGGGATAGTGGTTAACAGG + Intergenic
914359494 1:146920755-146920777 ATGTGAGGAAAGGGGTGAAATGG - Intergenic
914494256 1:148179120-148179142 ATGTGAGGAAAGGGGTGAAATGG + Intergenic
914655684 1:149738244-149738266 ATCTGGGGATAGTGGTTAACAGG - Intergenic
915528172 1:156488770-156488792 CAGTGGGGAGAGCGGTGAAGGGG + Intronic
915892348 1:159783651-159783673 CTGGGTGGTTAGTGGTGGAAGGG - Intergenic
916193563 1:162202000-162202022 CTATGGGGGTGGTGGAGAAACGG + Intronic
916403587 1:164474991-164475013 CAGTGGTGATAGTGGTGGTAGGG + Intergenic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
918405545 1:184208466-184208488 GTTTGGGGATGGTGGTGGAAGGG + Intergenic
920556868 1:206910229-206910251 TTCTGGGGCTGGTGGTGAAAAGG - Exonic
922598360 1:226831202-226831224 CTGTGGGGATAGTGGGCACATGG + Intergenic
923041458 1:230322861-230322883 CTGGGTGTACAGTGGTGAAATGG - Intronic
923338784 1:232990952-232990974 ATGTGGGGAGAGTGGGGAAGAGG + Intronic
923849326 1:237776365-237776387 CTGAAGGGACAGTGGTGAGAAGG - Intronic
1063220878 10:3966643-3966665 CTGTGGAGACAGTGAAGAAAAGG - Intergenic
1063953682 10:11247008-11247030 TTGTGGGGATGGTGGAGAAGGGG - Intronic
1065359926 10:24879920-24879942 CTGTGGGGTGAGTGGGGAGAAGG + Intronic
1065968749 10:30789190-30789212 GTGTGGTGACAGTGGGGAAAGGG + Intergenic
1066288263 10:33989669-33989691 TTTTGTGGATAGTGGGGAAATGG - Intergenic
1066402515 10:35090048-35090070 GTGTGGGGAGAGGGATGAAAGGG - Intronic
1066577219 10:36839359-36839381 GTGAGGGGATGCTGGTGAAATGG + Intergenic
1067709074 10:48634422-48634444 CTCTGGGAATGGTTGTGAAATGG - Intronic
1068344228 10:55750747-55750769 ATGTGAGGATAATGGTGAGAGGG - Intergenic
1068748171 10:60559270-60559292 CTCTGGGGACACTGGGGAAAGGG - Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1070016210 10:72534654-72534676 CTGTGGGCATAGTGAGGTAAGGG - Intronic
1070016501 10:72538087-72538109 CTGTGGGCATAGTGAGGTAAGGG - Intronic
1070391094 10:75971143-75971165 ATGTAGAGATATTGGTGAAAAGG + Intronic
1070529463 10:77324042-77324064 CTGTGGGGATTCTGGTGGTAAGG + Intronic
1070950601 10:80428092-80428114 CTGTGGGGATCTTGGTGTCAGGG + Intronic
1071232366 10:83603321-83603343 CTGTGAGAACAGTGATGAAAAGG + Intergenic
1071679171 10:87687184-87687206 CTGTGGGGATAGTGGTGAAAGGG - Intronic
1071710100 10:88041627-88041649 CTGTAGGTACAGTGGTGAACAGG - Intergenic
1072108614 10:92297042-92297064 CATTGGGGATGGTGGTCAAAGGG - Intronic
1073964730 10:108976391-108976413 GTGTGGGATAAGTGGTGAAAGGG + Intergenic
1075849932 10:125578748-125578770 CTGTGGGGATAATGGCTGAAGGG - Intronic
1076285103 10:129287822-129287844 ATGTGGGGAAGGTGGGGAAAGGG + Intergenic
1076305489 10:129463164-129463186 CTGTGGGGCTTGTAGTGGAATGG - Intergenic
1078099239 11:8319961-8319983 CTGTTGGGAGTGTGGTGAGATGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1081770227 11:45645794-45645816 CTGAGGGAGAAGTGGTGAAAAGG - Intergenic
1083562302 11:63682182-63682204 TTGAGGGGATGGTGGTGAAAGGG + Intronic
1083827116 11:65210175-65210197 CTGGGGTGCTAGTGGTGACATGG + Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1087059880 11:93967025-93967047 CTGTGTGGAAAGTGTAGAAAAGG - Intergenic
1087074339 11:94115248-94115270 ATGTGTGGACAGTGGTGGAAAGG - Intergenic
1087266148 11:96063379-96063401 CTGTGGGTACAGTGCTAAAAAGG - Intronic
1088242236 11:107784417-107784439 CTATAGGGATAATGGTGTAATGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089771583 11:120807030-120807052 CTGGGGCGATAATGGTGGAAGGG - Intronic
1089786098 11:120908353-120908375 CTGTGGGGGAAGGGGTGGAAAGG - Intronic
1090502571 11:127275839-127275861 CTGTGGGGTTTGTGGTGCCAAGG + Intergenic
1091047505 11:132337509-132337531 GGGTGGGGCTAGGGGTGAAAGGG - Intergenic
1092276054 12:7061706-7061728 ATGTGGGGATGTTGGTGATATGG + Intronic
1093174311 12:15894917-15894939 CTGTGGGCAGAATGGTTAAAGGG + Intronic
1096647107 12:53044894-53044916 ATGTGGGGATAGTGGAGAAGGGG - Intergenic
1098555891 12:71818300-71818322 CTGTGGAGATACTGGCCAAAGGG + Intergenic
1101180669 12:102213351-102213373 TTTTGGGGGTAGTGGGGAAAAGG + Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1103182353 12:118924696-118924718 CTGTGGATACAGTGGTGCAAAGG + Intergenic
1107611784 13:42121665-42121687 CTATGGGTGTAGTGGTGAGAAGG - Intronic
1108415486 13:50194347-50194369 CTGAGGCCATATTGGTGAAAAGG + Intronic
1109863723 13:68233950-68233972 CTGGGAGGGTAGTGGGGAAATGG + Intergenic
1110278162 13:73662070-73662092 CTGTGGGGACAGGCGTGACATGG - Intergenic
1110324099 13:74194195-74194217 CTGGGGTGGTGGTGGTGAAAAGG + Intergenic
1110742083 13:79009365-79009387 CTCTGGGGAGAATGGTGAAGGGG - Intergenic
1112782737 13:102919063-102919085 CTGGTGGGGTTGTGGTGAAAAGG - Intergenic
1112916503 13:104556790-104556812 CGGGTGGGATAGTGGCGAAATGG - Intergenic
1113986975 13:114325107-114325129 CTCTGGGGATAGTGGTGGGCCGG - Exonic
1114033541 14:18597938-18597960 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114078329 14:19177134-19177156 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1114125160 14:19717413-19717435 CTGTGGGGTCAGTGGTAATATGG + Intergenic
1117428818 14:55630785-55630807 CAGTGGGGAAAGTGGAGCAAGGG + Intronic
1118450830 14:65900723-65900745 CTGTGCTGATAGTGATGAAGAGG + Intergenic
1120921942 14:89763417-89763439 GTGTGGGGACAGTGGGGGAAGGG - Intergenic
1121191914 14:92038414-92038436 CTTTGGGGATAGAAATGAAAGGG - Intronic
1121781397 14:96624626-96624648 CTGTGGGGCCAGTGCAGAAACGG + Intergenic
1121847944 14:97190615-97190637 CTTTGGGGATTCGGGTGAAAGGG - Intergenic
1122723075 14:103732844-103732866 TTGTGGGGATAGGGGGCAAATGG - Intronic
1124048683 15:26175300-26175322 CTGTGGGGATAGTTCCAAAAAGG + Intergenic
1125035188 15:35115529-35115551 CTGTGATGGTAGTGATGAAAAGG + Intergenic
1125844559 15:42839582-42839604 CTGGTGAGATGGTGGTGAAAAGG - Intronic
1126601965 15:50437816-50437838 CTGTAGTGATAGGGGAGAAAAGG - Intronic
1126693027 15:51302611-51302633 CTGTGAGGACAGTGGGGAGAGGG - Intronic
1126748808 15:51854471-51854493 CTATGGAAATGGTGGTGAAATGG + Intronic
1127822189 15:62668058-62668080 ATGGGGAGATAGTGGTCAAAGGG + Intronic
1128063874 15:64752236-64752258 CTGAGGGGCCAGTGGTGCAATGG - Intronic
1129286599 15:74530319-74530341 TTGTGGGGAGAGAGATGAAAGGG + Intergenic
1133741658 16:8656377-8656399 CTGTGGGGGAAGTGGGGAAAAGG - Intergenic
1134375018 16:13664092-13664114 CTGTGAGGATATTGTTCAAATGG - Intergenic
1134510679 16:14844469-14844491 CTAGGGGGATAGGGGTGAGAGGG + Intronic
1134698318 16:16242955-16242977 CTAGGGGGATAGGGGTGAGAGGG + Intronic
1134973516 16:18551722-18551744 CTAGGGGGATAGGGGTGAGAGGG - Intronic
1135869926 16:26140101-26140123 CTGTGGAGCTAATGGTGATAAGG + Intergenic
1135869937 16:26140282-26140304 CTGTGGAGGTAATGGTGATAAGG + Intergenic
1137079601 16:36029716-36029738 CTCTGGGGATGGTTGTGGAATGG + Intergenic
1138060940 16:53889601-53889623 CGGCTGGGATGGTGGTGAAATGG + Intronic
1138529841 16:57629140-57629162 GGGTAGGGATGGTGGTGAAATGG + Intronic
1139587272 16:67912012-67912034 CTGTGGGCCTAGGGGTGAAGGGG + Intronic
1203141770 16_KI270728v1_random:1771629-1771651 CAGTGGGGAGAGTGTGGAAACGG + Intergenic
1142935469 17:3326709-3326731 CTGTGGGGACTGTGGTGGAGTGG - Intergenic
1143476964 17:7208397-7208419 CTGTTGGGAGAGTGGAGAGAGGG - Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1144418005 17:15069934-15069956 CTTTGGGTATAGTGGGGAATAGG - Intergenic
1144435690 17:15238383-15238405 CTGGGGACAGAGTGGTGAAATGG + Intronic
1145407103 17:22610865-22610887 ATGTGAGGATAATGGTGAGAGGG - Intergenic
1145776588 17:27533219-27533241 CAATGGGGATAGTTGTGATAGGG + Intronic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1148507070 17:48135897-48135919 ATGTGGGGATTTTGGGGAAATGG + Intronic
1149000449 17:51752088-51752110 CTATGGGAAGAGTGGGGAAAAGG - Intronic
1150269139 17:63851221-63851243 CTATGGGGATAGTGGGGTGAGGG + Intergenic
1150287130 17:63960854-63960876 GTGTGGAGATAGGGGTGAAGGGG - Intronic
1150441540 17:65195566-65195588 CTCAGGGGAAAGGGGTGAAAAGG - Intronic
1151315661 17:73320596-73320618 TTGTGGGGAGAGTGAGGAAAAGG + Intergenic
1152164019 17:78689772-78689794 CTGGGTGGACATTGGTGAAATGG - Intronic
1154012136 18:10583568-10583590 CCGTGTGGATACTGGTGAAAGGG + Intergenic
1154111876 18:11577260-11577282 CTCAGGGGACAGAGGTGAAATGG - Intergenic
1156576714 18:38325484-38325506 CTTGGGGAAAAGTGGTGAAATGG - Intergenic
1158729348 18:60005014-60005036 CTTTGGGGATTTTGGGGAAAAGG - Intergenic
1160507851 18:79437220-79437242 GTGAGGGGATAGTGGAGAGAGGG + Intronic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1164354026 19:27394699-27394721 CTTTGAGGCTTGTGGTGAAAAGG - Intergenic
1164746300 19:30617288-30617310 CTCTGGGGACTGTGGGGAAAGGG - Intronic
1164821352 19:31253801-31253823 CTGAAGGGACAGTGGTGAACTGG - Intergenic
1164934966 19:32202967-32202989 CTGGGGAGATGGTGATGAAAAGG - Intergenic
1166518108 19:43462295-43462317 CTAAGGGGATAATGGTGAGAGGG - Intronic
1167458845 19:49613623-49613645 CTGTGGACATGCTGGTGAAATGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168259614 19:55186076-55186098 CTGGGGGGAGAGTGGGGAACAGG + Intronic
1168575205 19:57503446-57503468 CTGTGGGGATAGACATGAGATGG + Intronic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
927226599 2:20771955-20771977 TTGCAGGAATAGTGGTGAAAAGG - Intronic
927352364 2:22131805-22131827 ATGTGGGGATAATGAAGAAAAGG + Intergenic
927993091 2:27461944-27461966 CTGTTGGTATAGTAGTTAAAAGG - Intronic
929187226 2:39108064-39108086 AAGTGGGGATGGTGATGAAAGGG - Intronic
929918546 2:46155794-46155816 CAATGGGGATAGTGGGGAGAAGG - Intronic
930873052 2:56185958-56185980 ATGTGGGGATAGGAGTGGAAAGG - Intronic
931119115 2:59196915-59196937 CTGTGGGGATAGAGGTGCCTTGG + Intergenic
934013718 2:87855161-87855183 ATGTGGAGATAATGGTAAAAGGG - Intergenic
934044815 2:88164201-88164223 CTGTAGGCACAGTGGTGAACGGG + Intergenic
935418009 2:102838724-102838746 CTGTGGGGTAATTGGTGGAATGG + Intronic
937912574 2:127082569-127082591 CTGGGGTGGCAGTGGTGAAAGGG + Intronic
939222262 2:139317425-139317447 CGGTGGGGATAATGGAGAATAGG + Intergenic
941050336 2:160725492-160725514 CTGTGGGGTCAGTGGTGATATGG + Intergenic
941290424 2:163667318-163667340 TTGTGGGGATAGTATGGAAAAGG - Intronic
942686898 2:178542228-178542250 AGGTGGGGAGAGTGGTGGAAGGG + Intronic
942845052 2:180414026-180414048 CTTTGGGGACATGGGTGAAAGGG - Intergenic
943994063 2:194736374-194736396 CTGTGAGGACAGTGATGAGAGGG - Intergenic
944985469 2:205170635-205170657 CTCTGCTGATAGTGGAGAAAAGG - Intronic
946111022 2:217417506-217417528 TTGTGGCGATGGTGGTGATAGGG - Intronic
946336974 2:219044300-219044322 CTTGAGGGATAGAGGTGAAAAGG + Intergenic
947080802 2:226394046-226394068 CTGTGGGGGTAGTGGTTGACTGG + Intergenic
948379951 2:237544330-237544352 GTGGGGGGACAGTGGTGAATGGG + Intronic
948380124 2:237544972-237544994 GTGGGGGGACAGTGGTGAATGGG + Intronic
1168812660 20:715858-715880 ATGTGGGGAAAGTGGGGAGAGGG + Intergenic
1169554083 20:6731321-6731343 CTGTGTGTAAAGTGGAGAAAAGG - Intergenic
1170250899 20:14281407-14281429 GAGTGGGGATAGTGGAGAATGGG + Intronic
1170321485 20:15104043-15104065 CAGTGGAGATAGGGGAGAAATGG + Intronic
1172090929 20:32432074-32432096 TTGTGGGGAAAGTGTTGAGAGGG + Intronic
1173846612 20:46192672-46192694 CTGGGGGGATAGTGGAGAAGAGG - Intronic
1174743634 20:53040370-53040392 GTGTGGGGTAAGTGGTGCAAAGG + Intronic
1174899579 20:54484492-54484514 TTGGGGGGAAAGTGGTTAAAGGG - Intronic
1177428814 21:20962004-20962026 CAGTGTGGATAGAGGTGACAAGG - Intergenic
1177722168 21:24920938-24920960 CTGGGGAGATATTGGTCAAAAGG + Intergenic
1177812799 21:25942935-25942957 CTGTGGAGTTAGTGTTTAAAGGG - Intronic
1178959937 21:37056343-37056365 CCCTGGGGATAGTGGAGAGAGGG + Intergenic
1179272503 21:39862226-39862248 CTGTGTGGAGAGTGGAGACAGGG + Intergenic
1179985825 21:44919832-44919854 GTGTGGGGACGGTGGTGCAAGGG + Intronic
1180457655 22:15524997-15525019 CTGTGGGGTCAGTGGTAATATGG - Intergenic
1180667775 22:17528368-17528390 CCGTGGAGATAGAGGGGAAAAGG + Intronic
1181305761 22:21916467-21916489 GGGTGGGGATGGAGGTGAAAGGG - Intergenic
1182532501 22:30970690-30970712 CTGTGTGGTTGGTGGTGAATAGG + Intergenic
1183944732 22:41318787-41318809 CAGTGGGGAGGGTGGTGAATAGG - Intronic
950017856 3:9766980-9767002 CTGGGGGGAGAGTGGAAAAAGGG - Intronic
951626586 3:24671267-24671289 CTGTGGTTATAGTGGTGAGTAGG + Intergenic
951851276 3:27143568-27143590 TTGTGAGGGTAGTGGTCAAAGGG - Intronic
952748765 3:36806795-36806817 GAGTGGGGATTGTGGTGAACAGG - Intergenic
953305109 3:41821726-41821748 AAGTGAGGATAGTTGTGAAAAGG - Intronic
954456070 3:50600514-50600536 CAGTGGGGGTAGTGGGGGAAGGG + Intergenic
954887622 3:53890435-53890457 CTCTGGGGATATTGGTGGAAGGG - Intronic
955979844 3:64513869-64513891 CTGTAGGAGTAGTGGGGAAATGG - Intergenic
957850152 3:85797402-85797424 CTGTTGGGGTAGTGGGGTAAGGG - Intronic
958131165 3:89425892-89425914 CACTGGGGATAGTTGGGAAAAGG + Intronic
958959957 3:100500094-100500116 TTGTGGGGAGAGTAGTGGAAGGG - Intronic
961060273 3:123822793-123822815 GTGTGGGGACAGTGATGACAAGG - Intronic
961697810 3:128718093-128718115 CTGTGGGAAAAGAGGAGAAAAGG + Intergenic
965415134 3:168384136-168384158 CTGTGGTGATAGTGGCCACAGGG - Intergenic
967455101 3:189676293-189676315 ATGGGAGGATATTGGTGAAAGGG - Intronic
967613607 3:191538105-191538127 CAGCGGGGATAGTGGTGAGATGG + Intergenic
968817849 4:2831022-2831044 CTGTGGGGATAGCGGTTCCAGGG + Intronic
971147628 4:23996057-23996079 TTCAGGGGATAGTAGTGAAAGGG + Intergenic
972586252 4:40439173-40439195 CTGTCGGGGTACTGATGAAATGG - Intronic
973832483 4:54775577-54775599 CAGTGGGTAAAGTGGTGAACTGG - Intergenic
975758223 4:77592435-77592457 ATGGGGAGATATTGGTGAAAGGG + Intronic
975997283 4:80330907-80330929 CTGAGGATATAGTGGTGAAGAGG + Intronic
976656196 4:87491384-87491406 CTGTTGAGATATTAGTGAAAGGG - Intronic
976738440 4:88334174-88334196 CTGTGTGAACAGTGGTGAAGTGG - Intergenic
977818325 4:101442225-101442247 CTGTAGGGCTAGTGGGGGAAAGG - Intronic
979608911 4:122669853-122669875 GTGTGGGGACAGTGGAGACAGGG - Intergenic
980916106 4:139034575-139034597 TTGTGGTGGTGGTGGTGAAAGGG + Intronic
980989448 4:139726530-139726552 CTGTGGGGACTGAGTTGAAAGGG + Intronic
983234528 4:165163994-165164016 ATGTGGATATAGTGGTCAAAAGG - Intronic
983445638 4:167846848-167846870 CTGTGGGAATATTGCTGAAGAGG + Intergenic
984747290 4:183233929-183233951 CAGTGGAGAAAATGGTGAAAAGG + Intronic
987258722 5:16182332-16182354 TGGTGGGGATGGAGGTGAAAAGG - Intergenic
987434740 5:17881320-17881342 CTCTGGGGATACTGGGGGAAAGG - Intergenic
988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG + Intergenic
993584890 5:89711789-89711811 ATGTGGGGGTAGTGGTGGAGGGG + Intergenic
993644844 5:90450092-90450114 CTCTTGGGATAGCAGTGAAATGG - Intergenic
994682298 5:102903767-102903789 GTGTGGGGATAGTGATACAAAGG + Intronic
995767805 5:115637930-115637952 CTGTTGTGATAGTAGTGAGAGGG + Intergenic
996491107 5:124098386-124098408 CAGTAGGGATAGTGGTGAGAAGG - Intergenic
997227653 5:132221126-132221148 CTGTGGGCATAGTTATGAGATGG - Intronic
997797223 5:136822394-136822416 CTTTGGGGATGCTGGGGAAAGGG - Intergenic
998269677 5:140695369-140695391 CCTTGGGGATAGTGGAAAAAAGG + Intronic
998597526 5:143548812-143548834 ATGGGGAGATATTGGTGAAAGGG - Intergenic
1000569947 5:162899351-162899373 CTGTGGGGTTAGTGGTAATGGGG - Intergenic
1000822148 5:165997921-165997943 GTGAGGGGATTGTGGTGAAGTGG - Intergenic
1000918131 5:167106739-167106761 CTGTGGCAATAGAGGTGAAGAGG + Intergenic
1001234775 5:170020168-170020190 CTGCGGGGATGGTGGAGAAGAGG - Intronic
1001897178 5:175392607-175392629 CTGGGATGATAGTGGAGAAAGGG - Intergenic
1002286980 5:178170061-178170083 CCGTAGGGAGACTGGTGAAAGGG + Intergenic
1003522517 6:6870379-6870401 CTGTGGGGATAATGATTAGAAGG - Intergenic
1003957188 6:11174735-11174757 CAGTGTGGAGAGTGGTGAAGAGG - Intergenic
1004367593 6:15024912-15024934 TTGTGGGGGTAGTGGGGACAGGG + Intergenic
1005692687 6:28322421-28322443 CTGTGGGGCAAGTGGTGTACAGG - Intergenic
1006509649 6:34515095-34515117 CTGTGTGGAGAGTGGGGAACGGG + Intronic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1007208614 6:40172974-40172996 GTGGGGGGATGGTGGTGAGAGGG - Intergenic
1008882831 6:56398951-56398973 CTGTGAGGTTTGTGGGGAAAGGG + Intergenic
1011932701 6:92734011-92734033 CTTTGGGGATATTGGGGAAGCGG - Intergenic
1012763515 6:103333034-103333056 ACATGGGGACAGTGGTGAAACGG - Intergenic
1013373568 6:109491813-109491835 CTATGGAGAGAGAGGTGAAAAGG + Intergenic
1015838399 6:137448022-137448044 CTGAGGGGATAGAGGAGGAAAGG + Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016888670 6:148983877-148983899 ATGTGGGGGTGGTGGTGATAGGG - Intronic
1017046534 6:150351970-150351992 CTGGGGTGATGGTTGTGAAAAGG - Intergenic
1017352253 6:153456217-153456239 CTGTGGGATCAGTGGTGATATGG + Intergenic
1018619197 6:165714309-165714331 CTGTGGGGAAAGCGGGGAACAGG + Intronic
1019198800 6:170297211-170297233 CCGTGGGGACATTCGTGAAAGGG - Intronic
1020713677 7:11641522-11641544 CTGTGGGAATATTATTGAAATGG - Intronic
1021793379 7:24228299-24228321 CTTTGGGGGTAGGGGTAAAAAGG - Intergenic
1023624101 7:42099124-42099146 CTATGTGGATAGTGGGGAAGAGG - Intronic
1025042768 7:55662490-55662512 TTGTGGTGATAGTGGTGGATGGG - Intergenic
1025246674 7:57322823-57322845 ATGTGGTGATAGTAGTGGAAGGG + Intergenic
1025589916 7:62844952-62844974 CTTTGAGGTCAGTGGTGAAAAGG + Intergenic
1028027920 7:85869731-85869753 CTGTGGGGTTAGTGGTGATATGG - Intergenic
1028321287 7:89463166-89463188 CTGTGGGATCAGTGGTGATATGG + Intergenic
1029241572 7:99166928-99166950 CTGTGTGGGCAGTGGTCAAAAGG - Intergenic
1031553877 7:123147877-123147899 CTTTGGGAGTAGTGGTGAGAAGG - Intronic
1032225994 7:130032300-130032322 CAGTGGGGATGGTGGAGGAAGGG - Intronic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034339921 7:150346295-150346317 CTGTGTGGAGAGTGGATAAAAGG + Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1035191945 7:157177632-157177654 CTGAGGGGAAAGTTGTGAAAAGG + Intronic
1036204480 8:6794915-6794937 CTGTGGGGACAGTGTTGATTAGG - Intergenic
1037587599 8:20288700-20288722 CTGTGGGGAGAGGGGTGCCAGGG - Intronic
1037854851 8:22364353-22364375 CTGTGCGGTTTGTGGTGACAAGG - Intergenic
1037924049 8:22830782-22830804 ATGTGGTGGTAGTGGTGATAGGG - Intronic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1040272635 8:45971626-45971648 CTTTGAGGACTGTGGTGAAAAGG + Intergenic
1040294732 8:46143289-46143311 CAGAGGGGAAAGTGGTGAGATGG - Intergenic
1043340982 8:79239216-79239238 TGGTGGGGAAAGTGGTGCAAGGG - Intergenic
1043575352 8:81650293-81650315 ATGTGAGGCTAGAGGTGAAAAGG + Intergenic
1045243247 8:100420995-100421017 CGGTGGGGAAAGTGCTGGAAAGG + Intergenic
1046904660 8:119559363-119559385 ATGTGTGGACAGGGGTGAAAAGG + Intronic
1048941572 8:139404715-139404737 CTGTGGCTATAGTGGAGAAAAGG + Intergenic
1050398655 9:5227705-5227727 CTGTGGGGGTGGTGGGGCAAGGG + Intergenic
1052072691 9:24101917-24101939 CTGGGGAGATATTGGTCAAAAGG + Intergenic
1052446618 9:28569637-28569659 ATGGGGGGATATTGGTCAAAGGG + Intronic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1055188657 9:73490372-73490394 CTGTTGGTATAGTGGTGTGATGG + Intergenic
1055248392 9:74275044-74275066 CTGTGGGAGTAGGGGTGAACTGG - Intergenic
1055657516 9:78466479-78466501 TGGTGTGGATAGTGGTGAATCGG - Intergenic
1056631067 9:88293544-88293566 CTGTAGGAATAGGGGTGAACAGG - Intergenic
1056684484 9:88748335-88748357 CTGTGTGGATTTTGGTCAAAGGG - Intergenic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1058577616 9:106420716-106420738 CTGTGTGTACAGTGGTGATAGGG - Intergenic
1060237893 9:121878901-121878923 CTGTGGGGCTGGTGGTGCAGGGG + Intronic
1061074496 9:128332847-128332869 CAGGGGAGATCGTGGTGAAATGG + Exonic
1061823173 9:133239782-133239804 CTGTGGGGAGGATGATGAAAGGG - Intergenic
1186683678 X:11901729-11901751 CTGTTGTGAATGTGGTGAAAAGG - Intergenic
1187120909 X:16405273-16405295 AGGAGGGGAAAGTGGTGAAAGGG - Intergenic
1187441861 X:19327983-19328005 CTTTGGTGACAGTGGGGAAAGGG - Intergenic
1187577884 X:20577631-20577653 ATGTGGGGAAAGGGGTCAAAAGG + Intergenic
1189128427 X:38473413-38473435 CTGTGAGGATAGTGATTAAATGG - Intronic
1189769441 X:44408953-44408975 CTGAAGGGACAGTGGAGAAAGGG - Intergenic
1190457488 X:50640202-50640224 CTGAGGATATAGTGGTGAACAGG + Intronic
1191574685 X:62686435-62686457 CTTTGAGGACTGTGGTGAAAAGG + Intergenic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1194207704 X:91031750-91031772 ATGTGGAGATATTGGTCAAATGG + Intergenic
1194460925 X:94166345-94166367 GGGTGGGGATTGTGGTGAGAAGG + Intergenic
1195997278 X:110743872-110743894 TTGTGGGGATGGTGGTGAGGCGG + Intronic
1196047760 X:111274193-111274215 TTGTGGGGATAGTGGTAAGGAGG + Intergenic
1196263397 X:113612994-113613016 CTGTGGGGATAGGAGTGTATAGG - Intergenic
1196264281 X:113623652-113623674 CTGTGGGGAATGTGGAGAAAGGG - Intergenic
1197056017 X:122120121-122120143 ATGAGGAGATACTGGTGAAAGGG - Intergenic
1197368276 X:125594239-125594261 GTGTGGGGATAGGGGTGTAAGGG + Intergenic
1199130757 X:144183311-144183333 ATGTGGAGATAATGGTAAAAGGG + Intergenic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1200553506 Y:4606782-4606804 ATGTGGAGATATTGGTCAAATGG + Intergenic
1201353746 Y:13075067-13075089 CTGTGGGATCAGTGGTGATATGG - Intergenic
1202298485 Y:23385081-23385103 CTGGAGGAATATTGGTGAAATGG - Intergenic
1202572323 Y:26285518-26285540 CTGGAGGAATATTGGTGAAATGG + Intergenic