ID: 1071681394

View in Genome Browser
Species Human (GRCh38)
Location 10:87709408-87709430
Sequence TTTTATCATTAGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071681394 Original CRISPR TTTTATCATTAGAAGGAGGC TGG Intronic
900329193 1:2125690-2125712 TCTGATTATTCGAAGGAGGCTGG + Intronic
907976856 1:59439507-59439529 TTCTATCATTTTAAGGTGGCTGG - Intronic
908186714 1:61659290-61659312 TTTCATCACTAGAGGGAGACAGG - Intergenic
909504573 1:76373633-76373655 CTTTCTCATTACCAGGAGGCAGG - Intronic
910326116 1:86009221-86009243 TTCTATCATTAGAACAAGGTAGG + Intronic
912006406 1:104906619-104906641 TTTTATCAGTATTAGGAGGTGGG + Intergenic
912091978 1:106089410-106089432 TTTTACCATCAGAAGGGGGGTGG + Intergenic
913013065 1:114703957-114703979 TTTTTTCTTGAAAAGGAGGCAGG - Intergenic
913166883 1:116196065-116196087 GTTTATTATTAAAAGGAGGGAGG - Intergenic
914828448 1:151153121-151153143 TTTGATCCTAAGAAGTAGGCAGG - Intergenic
916731128 1:167567761-167567783 TTTTCTCTTTGGGAGGAGGCAGG + Intergenic
920509095 1:206537472-206537494 CTTTATAACTAGAAGCAGGCAGG + Intronic
920711756 1:208302085-208302107 TGTTATCTCTAGAAGCAGGCAGG - Intergenic
920805202 1:209227182-209227204 TTTTATTATTACAAGTAGACAGG - Intergenic
921712648 1:218388149-218388171 TTTTATTGTCAGAAGGAAGCTGG - Intronic
921800957 1:219401365-219401387 TTTTATTGCAAGAAGGAGGCAGG - Intergenic
1063273120 10:4534435-4534457 TTTTAAAAATAGAAGGGGGCTGG + Intergenic
1064203528 10:13303468-13303490 TTTTAAAATTAGAGGGATGCTGG + Intergenic
1064948826 10:20823566-20823588 TTTTATCATTAGGCAGATGCAGG + Intronic
1066398260 10:35047976-35047998 AATTATTATTAGATGGAGGCTGG + Intronic
1066762987 10:38774479-38774501 ATTTATCATTAAAAGTAAGCGGG - Intergenic
1067774398 10:49152104-49152126 TTTTATCATGTGACCGAGGCTGG - Intergenic
1069237771 10:66099421-66099443 TTTTATTATTATAAGGAGTATGG + Intronic
1071083569 10:81841524-81841546 TTTAATTTTTAGAAGTAGGCAGG - Intergenic
1071681394 10:87709408-87709430 TTTTATCATTAGAAGGAGGCTGG + Intronic
1072345217 10:94498383-94498405 ATTTATCATTAAAAAGATGCTGG - Intronic
1073357089 10:102865245-102865267 TTTTATCTTTATAAGGAGCTGGG - Intronic
1074016634 10:109541641-109541663 TTTGATCATTTGAAGGAGAAGGG + Intergenic
1075033289 10:119041658-119041680 ATTTATTTTTAAAAGGAGGCTGG + Intronic
1075523086 10:123155991-123156013 TTTTGTCCTTAGAAGTGGGCTGG + Intronic
1076053857 10:127355649-127355671 TTTTCCTACTAGAAGGAGGCAGG + Intronic
1076086295 10:127634973-127634995 TTTTATTAATAGAAGCAGCCAGG + Intergenic
1076518781 10:131066274-131066296 TTTTAGCATTACAATGAGGAAGG - Intergenic
1078914562 11:15767005-15767027 TATTATAATTAGAAGGATGTGGG + Intergenic
1079825209 11:25182163-25182185 TTTAATAATCAGAAGGAAGCAGG + Intergenic
1079845986 11:25468354-25468376 TTTTATCATTTGAAGGAGCAAGG + Intergenic
1080027481 11:27629522-27629544 TCTTATTAATAGAAGAAGGCAGG - Intergenic
1081320763 11:41689253-41689275 TTTTGCCATTAAAAGGAGGATGG + Intergenic
1081512036 11:43784644-43784666 TTTTATCATTTGAAGGAGCAAGG + Intronic
1084163325 11:67363194-67363216 TTTGCTCATCATAAGGAGGCTGG + Intronic
1085881740 11:80475192-80475214 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1085943182 11:81230702-81230724 TTCTTTCTGTAGAAGGAGGCAGG - Intergenic
1087132864 11:94683920-94683942 TTTTCTCTTGAGAGGGAGGCAGG + Intergenic
1087140752 11:94763432-94763454 TTTTATATTTAGAAAAAGGCAGG + Intronic
1090746033 11:129705469-129705491 TAATATCATTATGAGGAGGCTGG - Intergenic
1091093073 11:132791602-132791624 TTTTAGCATTAAAATGAGGTGGG - Intronic
1091397194 12:161334-161356 TTTTATCATTACTATGAAGCAGG + Intronic
1091865531 12:3832835-3832857 GTTTGTAATTAGAAGCAGGCTGG + Intronic
1092822617 12:12367057-12367079 TTTGATAATTAAAAGGAGCCTGG + Intronic
1093218024 12:16385339-16385361 TTTTGTCATTAGGTGGAGGGAGG + Intronic
1098071686 12:66682454-66682476 TTTTATCATAAGAAGGGGGTGGG + Intronic
1102893951 12:116583426-116583448 TTTTATCATTCAAAGAAGGGGGG + Intergenic
1103093920 12:118117872-118117894 TTTTTTTTTTAGACGGAGGCTGG - Intronic
1104183962 12:126410405-126410427 TTTTTACATTTCAAGGAGGCAGG - Intergenic
1105061495 12:133155614-133155636 ATTTGTCATTAGAAGAAGTCTGG + Exonic
1106611965 13:31292296-31292318 TTTTAGTATCAGAATGAGGCTGG + Intronic
1106671643 13:31912403-31912425 TTTTTTCATTATCATGAGGCAGG + Intergenic
1106769510 13:32948283-32948305 TTTGAACATTACAAGGAGGGAGG - Intergenic
1107793474 13:44026435-44026457 TTATGTCATTATAAGGAGGAAGG + Intergenic
1108691044 13:52859517-52859539 ATTTATCTTTGGAAGTAGGCAGG + Intergenic
1109037998 13:57291004-57291026 TTTTATGTTTAGAATGAGGTAGG - Intergenic
1109740006 13:66541104-66541126 ATTTATAGTTAGAAGGAGGAAGG - Intronic
1109887361 13:68559324-68559346 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1110684205 13:78352432-78352454 TATTATCAGTAAAAGGAGGAAGG - Intergenic
1111754692 13:92378363-92378385 TTTCATCATGAAAAGGAGGTTGG + Intronic
1111777180 13:92679119-92679141 TTTGATCATTAGCATGGGGCTGG + Intronic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1114161967 14:20178462-20178484 TGTTATGATTAGAGGGAGGGAGG + Intergenic
1114486802 14:23067690-23067712 TTTTATCGTGAGAGGCAGGCAGG + Intronic
1115054161 14:29102097-29102119 TTTTGTCATTGGAAGGACCCGGG + Intergenic
1115919944 14:38361338-38361360 TGTTATAATTAGATGGAGGGAGG + Intergenic
1116281958 14:42919602-42919624 TTTCGTCATTAGATGGAGGGAGG - Intergenic
1119279090 14:73388652-73388674 TTTTATAGTTTGAAGGTGGCTGG - Intronic
1119317630 14:73708760-73708782 TTTTCTTATTATAAGAAGGCAGG + Intergenic
1119828611 14:77680222-77680244 TTTTATCATTACCAAGATGCTGG - Intronic
1121096893 14:91223614-91223636 TTTTATTTTTGGAAGGAGGGGGG + Intronic
1121638158 14:95467625-95467647 GATTATAATTAGAAAGAGGCAGG + Intronic
1124560232 15:30766694-30766716 TTTTTTTTTTAGAGGGAGGCTGG + Intronic
1124972374 15:34500775-34500797 TTTGATCATTAGCATGGGGCTGG + Intergenic
1128552969 15:68609991-68610013 TTTTATCAAGAGAAGGAGGGTGG - Intronic
1128832058 15:70778548-70778570 TTTTTTTATTTTAAGGAGGCAGG + Intergenic
1129871099 15:78942225-78942247 TTTTTTTTTGAGAAGGAGGCTGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130353599 15:83111166-83111188 TTCTATGATAAGAATGAGGCCGG - Intronic
1131241585 15:90748498-90748520 AGATATCATTAGAAGGAGTCTGG - Intronic
1133471001 16:6075711-6075733 TTTAATCATTTTAAGGAGGGAGG - Intronic
1134319660 16:13151041-13151063 TATTATCATTAGCATGAGGTGGG + Intronic
1134458249 16:14410382-14410404 TTTAAGCATTAGGAAGAGGCCGG - Intergenic
1134597346 16:15506466-15506488 TTTTAAGATTAGGAGGGGGCTGG - Intronic
1135177667 16:20245193-20245215 TTTTATCATTAAAATGAGGGTGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1143643155 17:8211093-8211115 TTTTATAAAAAGAAGAAGGCCGG - Intergenic
1144105005 17:11976489-11976511 TCTTATTAATAGAAGAAGGCAGG + Intergenic
1146764582 17:35507739-35507761 TTTTATCATTTGAAGAAGTATGG - Intronic
1147525762 17:41221090-41221112 TTTTAGCATTAGAATGATGCTGG - Intronic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1149375481 17:56039737-56039759 TTTTATCATGAGAATTAGGGTGG - Intergenic
1149417768 17:56478136-56478158 TTTTAACATTAGAATAAGGAGGG + Intronic
1149965528 17:61160161-61160183 TTTTATCATTTAAAGCAGGGTGG + Intronic
1150490450 17:65570587-65570609 TTTATTCATTAGATGGAGTCTGG - Intronic
1151049462 17:70960479-70960501 TTTTCTTATTAGAAGGATGGAGG + Intergenic
1152160154 17:78663783-78663805 TTTTAAAATTAGAAGGAGGCTGG + Intergenic
1152455374 17:80412896-80412918 TTTTATCATTTGAAGAAGTATGG - Intergenic
1153568471 18:6444596-6444618 TTTTACCATTAAAATGAGGTGGG + Intergenic
1153734604 18:8052216-8052238 TTGTATCATAAGAAGCAGCCTGG - Intronic
1157358979 18:46961479-46961501 TTTTATCATTTGTAGGAGCAAGG + Intronic
1160049546 18:75420013-75420035 TTTTACCAGTAGATGGATGCTGG - Intronic
1168212635 19:54901669-54901691 TTTTATTTTTTAAAGGAGGCTGG + Intergenic
925838177 2:7965785-7965807 TTTTTTCCTGAGAAGGAGTCTGG - Intergenic
925915818 2:8604986-8605008 TTTAATAAGTAGAAGGAGGCAGG - Intergenic
926566700 2:14483507-14483529 TTTTACCATCAGAATGATGCTGG - Intergenic
929496759 2:42451426-42451448 TTTTAAAATTAGCAGGGGGCCGG + Intronic
930097762 2:47579808-47579830 TTTCATCATTTGAATGAGTCAGG + Intergenic
931145711 2:59514866-59514888 TTTTAACATTCTTAGGAGGCAGG - Intergenic
931813069 2:65873673-65873695 TTTTAGGATTTGAAGGAGGAAGG + Intergenic
931995517 2:67835693-67835715 ATTTACCATCAGAAAGAGGCAGG + Intergenic
932928648 2:76006772-76006794 TTCTATCATCATAAGGAGTCGGG + Intergenic
933509526 2:83222444-83222466 TTTTTACATTATAAGCAGGCAGG + Intergenic
934899534 2:98147256-98147278 TTATCTCATTAGTATGAGGCTGG + Intronic
936502293 2:113075583-113075605 TTTAATCACAAGAAGGAGGCAGG + Exonic
939259102 2:139783947-139783969 TTTTATCCTTAGATGGAGTTGGG + Intergenic
939836717 2:147138167-147138189 TTTTCTGATTAGTAGGAGGCTGG + Intergenic
939873362 2:147549370-147549392 TTTTGACATTGGTAGGAGGCAGG - Intergenic
940530833 2:154874087-154874109 TCTTATTACTATAAGGAGGCAGG + Intergenic
940717180 2:157239252-157239274 ATTTATAATTAGAAGGAGCAAGG - Intergenic
940970212 2:159888167-159888189 TTTTATCATTAAAAGGCCACAGG - Intronic
941087810 2:161138385-161138407 TTTTAACATTATAAGAATGCAGG - Intronic
941241610 2:163045670-163045692 TAGTATCATTAGGAGGAGTCTGG + Intergenic
941958239 2:171227109-171227131 TTTTACCAATAGAAAGAGGGTGG - Intronic
942108596 2:172658020-172658042 GCTGATCATTAGAAGGAGCCAGG - Intergenic
942896837 2:181067280-181067302 TTTTCTCTTTGGAAGGAGGTAGG + Intronic
944652288 2:201843196-201843218 TTTTTTTATTAGATGGAGTCTGG + Intronic
944975744 2:205048782-205048804 TTTTATTATTAAAAGAAAGCAGG + Intronic
945039186 2:205730049-205730071 TTGTGTACTTAGAAGGAGGCAGG + Intronic
945152674 2:206807292-206807314 TTTTATTAATATAAGAAGGCAGG - Intergenic
945154610 2:206825510-206825532 TTATATCATTAAAAGAAAGCTGG - Intergenic
945689603 2:213016955-213016977 TGTTATCAAGAGAAGGAGGAAGG + Intronic
1168864189 20:1070787-1070809 ATTTCTCATTAGAAGGACCCAGG - Intergenic
1168992932 20:2110042-2110064 TTATGTCATTATAAAGAGGCTGG - Intronic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1170215224 20:13884517-13884539 TTTTATTTTTAGAGGGAGTCTGG + Intronic
1170380706 20:15756688-15756710 TTTTATCATCTGAAGGGGGAAGG + Intronic
1172382109 20:34503289-34503311 TATTTTAATTAGAAGGGGGCAGG - Intronic
1172827997 20:37806646-37806668 TTTTAGCATTAAAATGAGGTAGG + Intronic
1174622236 20:51884587-51884609 GTTTTTCATCAGAATGAGGCTGG - Intergenic
1176786985 21:13269259-13269281 TTTTATTTTTAGATGGAGCCTGG + Intergenic
1178372487 21:32037876-32037898 TTTTAGCATTAAAATGAGGATGG - Intronic
1180131336 21:45829042-45829064 TCTTTCCATTATAAGGAGGCCGG - Intronic
1180687472 22:17680775-17680797 TTTTAGTATTATAATGAGGCTGG + Intronic
1181693844 22:24583072-24583094 TCTTCTCATTTGAAGGAGGTAGG - Intronic
1182787754 22:32921825-32921847 TATTATTATTAGGAGGAGGAGGG + Intronic
949976518 3:9465990-9466012 TATGAAAATTAGAAGGAGGCCGG + Intronic
951279010 3:20724490-20724512 TGTTATTATTAGAAATAGGCTGG + Intergenic
953005444 3:38973898-38973920 ATCTCTCTTTAGAAGGAGGCTGG + Intergenic
953038361 3:39233182-39233204 TTTTAGCATTAAAATGAGGAAGG - Intergenic
955695158 3:61628633-61628655 TTATATCATTAGAAGTTGACAGG - Intronic
956205897 3:66754402-66754424 TTTGATCAAGAGAATGAGGCAGG + Intergenic
956427216 3:69148771-69148793 TTTTGTCATGAGAAGTAGACAGG - Intergenic
956459947 3:69461944-69461966 TTTTATACTTAGTAAGAGGCAGG + Intronic
957830752 3:85515433-85515455 TTTTATTATTATATGGAGTCTGG + Intronic
960288882 3:115860373-115860395 TTTTATCATTAGAATGCTGAAGG + Intronic
961550141 3:127665899-127665921 TTTCCTCATTAAAAGGAAGCAGG - Intronic
961941906 3:130646764-130646786 TTTGCACATTATAAGGAGGCTGG + Intronic
962653037 3:137515477-137515499 TTTTTTCATTATAAGGATGACGG + Intergenic
962662983 3:137623871-137623893 TTTTAGCATTAAAATGAGGAAGG - Intergenic
964232819 3:154490428-154490450 TTTTATTATTAGGATGATGCTGG - Intergenic
964924444 3:161938490-161938512 TTTTATCATTTGAAGAAGTACGG - Intergenic
966238722 3:177730913-177730935 TATTATTATAAGAAGGAGGATGG + Intergenic
967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG + Intronic
967960558 3:194919165-194919187 TATTATTATTATATGGAGGCTGG + Intergenic
969653589 4:8482845-8482867 TCTTATTATTATAAGAAGGCAGG - Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
971925730 4:33007164-33007186 TTTTAGCATTAAAATGAGGAAGG - Intergenic
972020699 4:34310083-34310105 TGTAATCATTAGGAGGAGGTAGG + Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972490837 4:39585591-39585613 TTTTAATAATAGAAGTAGGCTGG - Intronic
974336846 4:60558883-60558905 TTTTATCTGTAGGAAGAGGCAGG + Intergenic
976376249 4:84348892-84348914 TATTATTATCAGAAGGAGACTGG + Intergenic
976814032 4:89125889-89125911 TTTTAGCATTAAAAGGAGGAAGG - Intergenic
979040232 4:115781855-115781877 TTTTAGCATTAAAATGAGGAAGG + Intergenic
979091634 4:116490468-116490490 TTTTATAATAAGAATTAGGCTGG - Intergenic
980215923 4:129852922-129852944 TTTTATCCTTAAATGGAGACTGG + Intergenic
981138427 4:141238940-141238962 TTTCTTCATCAGAAGGAGGTAGG + Intergenic
982680394 4:158421290-158421312 TTTTACATTTAGAAGGAGACTGG + Intronic
984246667 4:177283205-177283227 TCTTATCTTGAGAAGGATGCTGG - Intergenic
984594171 4:181648726-181648748 ATTAATCATTAGAAGGACACAGG - Intergenic
984964070 4:185126136-185126158 TTTTACCATTAAAATGAGGTGGG + Intergenic
987257939 5:16176317-16176339 TTTTATCAGTAGAAGTATGTGGG - Intronic
987691392 5:21271401-21271423 TTTTATTGCTAGAAGGTGGCAGG + Intergenic
988975872 5:36515405-36515427 CCTGATCATTAGGAGGAGGCAGG - Intergenic
989342847 5:40396012-40396034 TTTGATCATCACAAGGAGGATGG - Intergenic
989503564 5:42198565-42198587 TTTAAACATCAGATGGAGGCTGG - Intergenic
989675605 5:43968791-43968813 TTTTAAGACTAGAAGGGGGCTGG - Intergenic
990101983 5:52202192-52202214 TTTTTTTTTTAGAAGGAGTCTGG + Intergenic
991072261 5:62497147-62497169 TTTTGTTATTAGAAGGAGACTGG + Intronic
991262397 5:64681003-64681025 GTATATCATTAGAAGGAGATGGG - Intergenic
991306494 5:65181880-65181902 TTTTAAAATGTGAAGGAGGCAGG - Intronic
991434232 5:66580124-66580146 ATTAATCAATAGAAGGAAGCAGG - Intergenic
991748984 5:69778737-69778759 TTTTATTGCTAGAAGGTGGCAGG - Intergenic
991800565 5:70358548-70358570 TTTTATTGCTAGAAGGTGGCAGG - Intergenic
991828035 5:70651493-70651515 TTTTATTGCTAGAAGGTGGCAGG + Intergenic
991892922 5:71357988-71358010 TTTTATTGCTAGAAGGTGGCAGG - Intergenic
992217971 5:74544265-74544287 TTTTATTAATAGCAGGAGGCCGG + Intergenic
992691896 5:79248602-79248624 TATAATTATAAGAAGGAGGCCGG - Intronic
994385464 5:99125979-99126001 TTTTACCATTAAAAGTAGTCAGG - Intergenic
995898952 5:117046855-117046877 TCTTATTAATATAAGGAGGCAGG - Intergenic
996399521 5:123046417-123046439 TGATATCCTTAGAAGGAGGGTGG - Intergenic
997684392 5:135778554-135778576 TTTAATATTTAGAAGGAGACAGG + Intergenic
999214028 5:149916545-149916567 TTTTAACAATGCAAGGAGGCGGG - Intronic
1004165958 6:13256561-13256583 ATATATCATTAGAAGCAGCCAGG + Intronic
1004604629 6:17182351-17182373 TTTTAACATTATTAAGAGGCTGG - Intergenic
1005897483 6:30190522-30190544 TTCTATTATTAAAAGGAGGAAGG - Intronic
1006522164 6:34577161-34577183 TTATATCCATAAAAGGAGGCCGG - Intergenic
1008092059 6:47303905-47303927 ATTTAGCATTAGCAGAAGGCTGG - Intronic
1009927524 6:70137968-70137990 TTTCATCATTTGAAGTATGCAGG - Intronic
1011135323 6:84093771-84093793 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1011142016 6:84168723-84168745 ATTTATCAATAGAAGGAGTTTGG - Intronic
1011559634 6:88601414-88601436 GGTTATCATGAGAAGGAGACTGG + Intergenic
1013993585 6:116281082-116281104 ATTTCTTATAAGAAGGAGGCAGG + Intronic
1014891959 6:126854001-126854023 TTTTATGAATATAAGAAGGCAGG + Intergenic
1014966640 6:127761486-127761508 TTTTAGCATTAAAATGAGGAAGG - Intronic
1015172344 6:130267332-130267354 TTTTATCATTTGAAGAAGTACGG - Intronic
1015752845 6:136578160-136578182 CTTTATCATTAGGATAAGGCTGG - Intronic
1016242551 6:141947925-141947947 TTTAATCATTGGAAGGATGTGGG - Intergenic
1019091647 6:169540439-169540461 TTTTTTCTTTAGAGGGAGTCTGG + Intronic
1019269403 7:138564-138586 TTTTAACATTTCAGGGAGGCAGG + Intergenic
1020803769 7:12762864-12762886 ATTTATTTTTAGAAGGAGTCTGG - Intergenic
1021099078 7:16568222-16568244 CTTTATGATTACAAGGTGGCTGG + Intronic
1022043296 7:26601669-26601691 TTTTATCATTGGAGGTAGGGTGG + Intergenic
1024152602 7:46588082-46588104 TTTTTTAATTAGATGGAGTCTGG - Intergenic
1024188847 7:46984670-46984692 TTATAAAATAAGAAGGAGGCAGG + Intergenic
1026071707 7:67127454-67127476 TTTTGTTATTATAAGGAGGCCGG - Intronic
1026705192 7:72684812-72684834 TTTTGTTATTGTAAGGAGGCTGG + Intronic
1027379452 7:77590858-77590880 TTTTTTTAATAGATGGAGGCCGG - Intronic
1027488182 7:78787794-78787816 TTTTAACATTTGATGGAGCCAGG + Intronic
1027832068 7:83190642-83190664 TTTCTTCATTAGAAGGAGACAGG - Intergenic
1028398410 7:90397765-90397787 TTTTATCCCTAGAATGAAGCTGG + Intronic
1028891424 7:95992255-95992277 ACTTATCATTAGATGGAGGGAGG - Intronic
1031134284 7:117869037-117869059 TCTTATTATTGGAAGGATGCAGG + Intronic
1032273195 7:130430435-130430457 TTTTATCCTTAGAAAAAGGTTGG + Intronic
1032557052 7:132847199-132847221 TTATATCATGCAAAGGAGGCTGG + Intronic
1032776194 7:135116010-135116032 TTTTATCTTTAGAAGAAAACTGG - Intronic
1033201799 7:139379378-139379400 TTTTCTCATTATAAAGAGGTTGG + Intronic
1034573682 7:151979408-151979430 TTTTAAGAGTAAAAGGAGGCCGG - Intronic
1034959799 7:155358171-155358193 TTTCATCATTCGCAGGAGGATGG + Exonic
1036637803 8:10563903-10563925 TTTTGTGCTTAGAGGGAGGCCGG - Intergenic
1038100922 8:24374069-24374091 TTTTAATAATAAAAGGAGGCAGG + Intergenic
1038331468 8:26612807-26612829 TTTAAGCTGTAGAAGGAGGCAGG + Intronic
1038716208 8:29993523-29993545 TTTCAACATTTGAAGGAGTCAGG - Intergenic
1038822729 8:30967704-30967726 TTTTGCCATTACAAGGAGGCCGG - Intergenic
1040849118 8:51880192-51880214 TTTTTTCATTAAAAGGAGACAGG - Intronic
1040873023 8:52120494-52120516 TTTCAAGATCAGAAGGAGGCAGG + Intronic
1041517639 8:58718259-58718281 TTTTATTATTGGAATGAGGTTGG - Intergenic
1041552133 8:59115014-59115036 TTTTATCATTGAAATGAGGAAGG - Intronic
1041609980 8:59834398-59834420 CTTTATAATTCAAAGGAGGCAGG - Intergenic
1042858145 8:73287829-73287851 TTTTATATTAAGAGGGAGGCAGG + Intergenic
1044069259 8:87736314-87736336 TTTTATCATTATAAAGATACTGG + Intergenic
1044689061 8:94858967-94858989 GTTTAAAATAAGAAGGAGGCTGG + Intronic
1045424887 8:102055881-102055903 TTTGATCTATAGTAGGAGGCAGG - Intronic
1045659142 8:104418367-104418389 TTTTAACATTAAATGCAGGCTGG - Intronic
1046163440 8:110397028-110397050 TCTGATCATCAGAAGGAGGCAGG + Intergenic
1046696019 8:117340482-117340504 ATCTCTCATTAGAAGGAGGCTGG - Intergenic
1047407190 8:124595575-124595597 GATTCTCATAAGAAGGAGGCAGG - Intronic
1048843345 8:138583970-138583992 TTAAATCATTAAAAGGAGGGAGG - Intergenic
1049480971 8:142822492-142822514 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1051784249 9:20724430-20724452 TTTTAACAGTGGAAGGATGCTGG + Intronic
1051982413 9:23038134-23038156 TTTTGTCATTAGTTGGAGGCTGG + Intergenic
1055954757 9:81763374-81763396 TTTTATCATCACAAGAATGCGGG - Intergenic
1056268968 9:84927653-84927675 TTGTATAATTAGTAAGAGGCAGG - Intronic
1057407129 9:94782775-94782797 TTTTCCCATTAGAAAGATGCCGG + Intronic
1059600934 9:115777955-115777977 TGCTAGCATTAGAAGAAGGCAGG + Intergenic
1059666240 9:116448963-116448985 TTTTATGATCACAATGAGGCAGG + Intronic
1060760073 9:126239515-126239537 TTTTTTTTTTAGAAGGAGTCTGG - Intergenic
1061223346 9:129265360-129265382 TTTCAGCTCTAGAAGGAGGCTGG - Intergenic
1185812500 X:3123790-3123812 TTTTAGCATTAAAATGAGGCAGG + Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1186641111 X:11456917-11456939 TTTTATCCTTAAAAGAGGGCTGG + Intronic
1187122570 X:16423493-16423515 TCTTATGATTAGAAGGAGGAAGG - Intergenic
1187433528 X:19246557-19246579 GTTTATCTGTAGAAGGAGACAGG - Intergenic
1187940983 X:24380789-24380811 TTATATCATTAGACTGGGGCAGG - Intergenic
1188849883 X:35118664-35118686 TTTAATCATAAGGAGGAGGTAGG - Intergenic
1189146348 X:38658942-38658964 TGGTATCATTAAAAGGAGACAGG - Intronic
1191091071 X:56622271-56622293 TTTTATCATTAAAAAGAGACTGG + Intergenic
1191688480 X:63916328-63916350 ATTTCTAATTAGAAGGAAGCTGG + Intergenic
1192239160 X:69315641-69315663 TTTCATAATAAGATGGAGGCGGG - Intergenic
1194583279 X:95702436-95702458 TTTTATCATAAAAGGGATGCTGG + Intergenic
1194816355 X:98446662-98446684 TTTAATCATCAGTAGGAAGCAGG - Intergenic
1194864712 X:99051975-99051997 TAACACCATTAGAAGGAGGCTGG - Intergenic
1194979717 X:100427979-100428001 TATTATAATTATAAGGAGGTAGG - Intergenic
1195473140 X:105256132-105256154 TTTTATTATTAGAACAATGCTGG + Intronic
1195976627 X:110534264-110534286 TTTTATAATTAGAGGGATGGAGG + Intergenic
1196866486 X:120075935-120075957 TTTCTTCCATAGAAGGAGGCTGG - Exonic
1196876613 X:120160346-120160368 TTTCTTCCATAGAAGGAGGCTGG + Exonic
1196900252 X:120375543-120375565 GTTCATCTTTAGAAGGATGCAGG - Exonic
1196910576 X:120480790-120480812 GTTTGTCATTAAAAGGAGCCAGG + Intergenic
1199598079 X:149523873-149523895 TCTGATCATCAGGAGGAGGCAGG + Intronic
1202024719 Y:20509017-20509039 TTGTATCACTGGAAGGAGGTAGG - Intergenic
1202351630 Y:23998630-23998652 TTTTAGCATCAGAATGATGCTGG - Intergenic
1202519149 Y:25671489-25671511 TTTTAGCATCAGAATGATGCTGG + Intergenic