ID: 1071683757

View in Genome Browser
Species Human (GRCh38)
Location 10:87733893-87733915
Sequence GGTGGCCTGTGACCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071683751_1071683757 20 Left 1071683751 10:87733850-87733872 CCTACTATGTCTCCTATCTTAGT 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1071683757 10:87733893-87733915 GGTGGCCTGTGACCAAAACCTGG No data
1071683750_1071683757 21 Left 1071683750 10:87733849-87733871 CCCTACTATGTCTCCTATCTTAG 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1071683757 10:87733893-87733915 GGTGGCCTGTGACCAAAACCTGG No data
1071683749_1071683757 22 Left 1071683749 10:87733848-87733870 CCCCTACTATGTCTCCTATCTTA 0: 1
1: 0
2: 0
3: 14
4: 184
Right 1071683757 10:87733893-87733915 GGTGGCCTGTGACCAAAACCTGG No data
1071683747_1071683757 29 Left 1071683747 10:87733841-87733863 CCTGTTCCCCCTACTATGTCTCC 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1071683757 10:87733893-87733915 GGTGGCCTGTGACCAAAACCTGG No data
1071683748_1071683757 23 Left 1071683748 10:87733847-87733869 CCCCCTACTATGTCTCCTATCTT 0: 1
1: 0
2: 1
3: 19
4: 214
Right 1071683757 10:87733893-87733915 GGTGGCCTGTGACCAAAACCTGG No data
1071683752_1071683757 8 Left 1071683752 10:87733862-87733884 CCTATCTTAGTGACAGCTTCACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1071683757 10:87733893-87733915 GGTGGCCTGTGACCAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071683757 Original CRISPR GGTGGCCTGTGACCAAAACC TGG Intronic
No off target data available for this crispr