ID: 1071685592

View in Genome Browser
Species Human (GRCh38)
Location 10:87751955-87751977
Sequence TGAGTGTGCTTGTGTAAAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 350}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071685592 Original CRISPR TGAGTGTGCTTGTGTAAAAA TGG (reversed) Exonic
901233573 1:7655016-7655038 TGGGTGTGTTTGTGTATATAGGG - Intronic
902808814 1:18876850-18876872 TGTGTGTGCTTATGTGCAAATGG + Intronic
903306094 1:22414338-22414360 TGAGAGTCCTTGTGTAAACACGG - Intergenic
904087049 1:27916621-27916643 TGTGTGTGTGTGTGTAAAACAGG + Intergenic
905323798 1:37136165-37136187 TGAGTTTGCTGTTGAAAAAAAGG - Intergenic
906665793 1:47621150-47621172 TGTGTGTGTTTGTTTATAAATGG + Intergenic
907513354 1:54978676-54978698 TGAGTGTGCTTGTTTAGAGAGGG + Intergenic
907720272 1:56965410-56965432 TGTGTGTGTGTGTGTAAGAAGGG + Intronic
908024785 1:59939114-59939136 TTACTGTGTCTGTGTAAAAAGGG - Intergenic
908288805 1:62640675-62640697 TGAGTTTGCTGTTGTACAAAGGG - Intronic
909310563 1:74141975-74141997 TGTGTGTGTGTGTGTATAAATGG - Intronic
909787003 1:79626049-79626071 TGTGTGTGTGTGTGTAAAACAGG - Intergenic
911380495 1:97107674-97107696 TCAGTGTTGTTGTGTATAAATGG - Intronic
911463679 1:98223758-98223780 TGAGTGTGTGTGTGTGAAAAGGG + Intergenic
912877128 1:113371346-113371368 TTTGTGGGCTTGTGTAGAAAAGG + Intergenic
915866156 1:159501188-159501210 GGAGAGTGCTTGAGTAAAACAGG - Intergenic
916680963 1:167104769-167104791 TGATTGGGCTTTTGCAAAAAAGG - Intronic
917627236 1:176858829-176858851 TGAGTTTGCTTCTCTAACAAGGG - Intronic
917935418 1:179862084-179862106 TGTGAGAGCTTGTTTAAAAATGG - Intronic
917941492 1:179927093-179927115 TCAGTTTCCTTGTCTAAAAATGG + Intergenic
918523432 1:185439633-185439655 TGAGAGTGGTTGAGTTAAAAGGG + Intergenic
918695973 1:187546692-187546714 TGTGTGTGTGTGTGTAGAAAAGG - Intergenic
919249286 1:195031193-195031215 TGTGTGTGTGTGTGTATAAAGGG + Intergenic
921100440 1:211924283-211924305 TGCCTGTGCTTTTTTAAAAAGGG + Intergenic
924230285 1:241957086-241957108 TGTGTGTGTGTGTGTAAAAGGGG + Intergenic
924811170 1:247403634-247403656 TGCGTGTCCTTGTGTACACATGG + Intergenic
1063027314 10:2193213-2193235 TGAGTGTGTATATGTAATAAGGG + Intergenic
1064015025 10:11765017-11765039 AGAGTGTGCTCTTGAAAAAAAGG + Intergenic
1064827521 10:19421895-19421917 TGAGTGTGTTTGTGCCAAGAAGG + Intronic
1065828689 10:29595320-29595342 TGAGTTTGCTAGGGTAAGAATGG + Intronic
1067596015 10:47558556-47558578 TGTGTGTGTGTGTGTAGAAATGG + Intergenic
1069016835 10:63439139-63439161 TGAAGATGCTTGTGTGAAAACGG + Intronic
1069018860 10:63464322-63464344 TGAGTGTGTTTTTGTAAACTCGG - Intronic
1069530847 10:69218243-69218265 TTTGTTTGCTTGTGTAATAAAGG + Intergenic
1070183156 10:74033912-74033934 TGAGAGGGCAGGTGTAAAAAAGG - Intronic
1070541347 10:77417619-77417641 TGAATGTTCTTGTTTACAAAAGG + Intronic
1070805157 10:79266566-79266588 TGTGTGTGCTTCTGTAAGATGGG - Intronic
1071460755 10:85892796-85892818 TGAAAGTGTTTGTGTAAAATTGG - Intronic
1071680780 10:87703302-87703324 TGTGTGTGTGTGTGTAAAACTGG + Intronic
1071685592 10:87751955-87751977 TGAGTGTGCTTGTGTAAAAATGG - Exonic
1073854676 10:107660837-107660859 TGTGTGTGTATGTGTATAAAGGG - Intergenic
1074206273 10:111285759-111285781 TGAGGGTGGGTGTGTAAAGAGGG + Intergenic
1074221726 10:111444688-111444710 TGAGTGTGCTACTGGAAGAATGG + Intergenic
1074405078 10:113174368-113174390 TCAGTTTACTTGTGTATAAAAGG - Intergenic
1074964095 10:118473475-118473497 TGGGTGTGTGTGTGTAAAAGAGG - Intergenic
1075654947 10:124155139-124155161 TGAGTGTGCATGTGTGAGCATGG - Intergenic
1075884643 10:125888005-125888027 TGAGTGGGCTTAGGGAAAAAAGG - Intronic
1076178844 10:128389887-128389909 TTAGAGTGCTTCTGTAAAAGTGG + Intergenic
1077847431 11:6040553-6040575 TGTGTGTGTGTGTGTATAAATGG + Intergenic
1077926676 11:6688092-6688114 TGTGTGTGTGTGTGTATAAATGG + Intergenic
1078930341 11:15907569-15907591 TGTGTGTGCATGTGTATATAGGG - Intergenic
1079004436 11:16782063-16782085 TGTGTGTGTCTGTGTATAAAAGG - Intronic
1080201225 11:29672844-29672866 TGTGGGTGTTTGTGTAAAATTGG - Intergenic
1080787712 11:35490826-35490848 TCAGTGTCCTTTTATAAAAAAGG - Intronic
1081525801 11:43926753-43926775 TGTGTGTGTTTGTGTAAGACAGG + Intronic
1082045137 11:47719601-47719623 TGTGTGTGTGTGTGTATAAAAGG + Intronic
1083166585 11:60891896-60891918 TCAGTGTGTTTGTATAACAAAGG - Intronic
1083552274 11:63598909-63598931 TGAGTGTGCGTATGTGAGAAGGG + Intronic
1085363604 11:75916283-75916305 TTAGTCTGCTTTTGTAAAATGGG + Intronic
1086280021 11:85174270-85174292 TGAGTGTGCTTTGGTATGAAAGG - Intronic
1087984235 11:104657753-104657775 TGTGTGTGTGTGTGTATAAATGG - Intergenic
1088006242 11:104944381-104944403 TGTGTGTGTGTGTGTAAGAAAGG + Intronic
1088682347 11:112254204-112254226 TGTGTGTGTGTGTGTGAAAAGGG + Intronic
1089217981 11:116847293-116847315 TGAGTGTGGGTGTGTAAAGGAGG - Intronic
1089927649 11:122275641-122275663 TGAATGACCTTGTGTGAAAATGG + Intergenic
1090007995 11:123019434-123019456 TGACTGGGGTTGTGTTAAAAGGG - Intergenic
1090401369 11:126451134-126451156 TGTGTGTGCATGTGTAAATGTGG + Intronic
1091189710 11:133680930-133680952 TGTGTGTGTGTGTGTATAAAGGG - Intergenic
1092180998 12:6446770-6446792 TGTGTGTGTGTGTGTGAAAAAGG - Intronic
1092937631 12:13378825-13378847 TGTGTGTGTGTGTGTGAAAATGG + Intronic
1094234123 12:28144080-28144102 TTTGTGTGCTCGTGCAAAAAAGG - Intronic
1096004963 12:48162023-48162045 TGAACCTGCTTGTGTAAAAGTGG - Intronic
1096232769 12:49905603-49905625 TAAGTGTGTTTGTGCAAAATTGG - Intergenic
1096597028 12:52702422-52702444 TGTGTGTGTGTGTGTATAAATGG + Intronic
1096803176 12:54125187-54125209 GGGGTGTGTGTGTGTAAAAAAGG - Intergenic
1097839651 12:64309464-64309486 TGAGTATGCTAGTCTTAAAAAGG - Intronic
1098706489 12:73697847-73697869 TGAGTGTGCATGTGTTTAGAAGG + Intergenic
1099471348 12:83053137-83053159 TGAATATGCTTTTGTCAAAATGG + Intronic
1099784676 12:87246378-87246400 TGTTTGTGTGTGTGTAAAAATGG - Intergenic
1100125121 12:91415473-91415495 TGTGTGTGTGTGTGTAAGAATGG + Intergenic
1100348590 12:93756369-93756391 TGAGGGTGCTTTCCTAAAAATGG - Intronic
1101875635 12:108595208-108595230 TGAGTGTGCATGTGTATGTATGG - Intronic
1102724850 12:115052751-115052773 TGTGTGTGCTTGTGTGCATATGG - Intergenic
1104449071 12:128854424-128854446 TGTGTGTGTGTGTGTAAAAGCGG + Intronic
1105601095 13:21887862-21887884 TGTGTGTGTGTGTGTGAAAAAGG - Intergenic
1105939494 13:25134653-25134675 GGAGTGAGCTTCTGAAAAAAGGG - Intergenic
1106051638 13:26195782-26195804 TGGGTGTGGGTGTGTAAGAAGGG - Intronic
1106957390 13:34955216-34955238 TGAGCCTGCTGGAGTAAAAACGG - Intronic
1107850527 13:44568155-44568177 TTAGTTTGCTTGTTTTAAAATGG - Intronic
1107975600 13:45685753-45685775 TGTGTGCGCATGTGTCAAAAAGG - Intergenic
1109667239 13:65555266-65555288 TGTGTGTGTTTGTGTTAAAATGG - Intergenic
1109758717 13:66797970-66797992 TGTGTGTGTGTGTGTAAGAAAGG + Intronic
1110030998 13:70613851-70613873 TGTGTGTGCATGTGTGAAACAGG - Intergenic
1110031134 13:70615437-70615459 TGTGTGTGCATGTGTGAAACAGG - Intergenic
1110552682 13:76826440-76826462 TGAATCTGCTTCTGTAAAATGGG + Intergenic
1110816720 13:79869203-79869225 TGAGGAGGCTTGTGTTAAAATGG + Intergenic
1113283330 13:108815436-108815458 GGAGTGTGACTGTGGAAAAATGG + Intronic
1113571125 13:111358969-111358991 TGAGCATGCTTGTTTAAGAAAGG - Intergenic
1114839213 14:26243755-26243777 TGTATGTGCTTCTGTAAAAATGG + Intergenic
1115006135 14:28487475-28487497 TGAGTGTGCTTGTGCAGCAATGG + Intergenic
1116579745 14:46624682-46624704 TGTGTGTGTGTGTGTACAAAGGG - Intergenic
1116751334 14:48889235-48889257 TGTGTGTGTGTGTGTAAAAATGG + Intergenic
1116911490 14:50470646-50470668 TGTGTGTGTGTGTGTAAAAATGG - Intronic
1117088931 14:52230000-52230022 TGAGGATGCTTAAGTAAAAAAGG - Intergenic
1118271823 14:64350592-64350614 TGTGTGTGTGTGTGTATAAAGGG + Intergenic
1118510533 14:66466946-66466968 TGTGTGTGCTTGTGTTTAACAGG + Intergenic
1119650437 14:76379268-76379290 TGTGTGTGCCTGTGTACAAATGG + Intronic
1119801820 14:77452228-77452250 TGCTACTGCTTGTGTAAAAATGG + Intronic
1119970955 14:78969842-78969864 TGTGTGTGTGTGTGTATAAAGGG + Intronic
1120161979 14:81155700-81155722 TGGCAGTGCTTGTGTAAGAAGGG - Intergenic
1121071590 14:91027467-91027489 TGTGTCTGTTTTTGTAAAAATGG + Intronic
1121849218 14:97204118-97204140 TGTGTGTGTGTGTGTAAATAGGG - Intergenic
1124105889 15:26737630-26737652 TGTGTGTGCGTGTGTACAAAAGG + Intronic
1125031272 15:35078440-35078462 AGAGTGTGCCTGTGTACAAGGGG + Intergenic
1125142473 15:36424936-36424958 TGAGTGTGTATGTTTAGAAATGG - Intergenic
1125460940 15:39906271-39906293 GGAGTGGGGTTGTGGAAAAAGGG - Intronic
1126731479 15:51687677-51687699 AGAGTGTCTTTATGTAAAAAAGG - Intronic
1126758199 15:51945000-51945022 TGATTGTGCCTGTGAAATAATGG - Intronic
1126845469 15:52756465-52756487 TTAGTTTTCTAGTGTAAAAATGG + Intergenic
1127566966 15:60199190-60199212 TGTGTGTGTGTGTGTAGAAAAGG - Intergenic
1127814250 15:62592828-62592850 TGTGTGTGCATGTGAGAAAAGGG + Intronic
1128262453 15:66241859-66241881 TGAGTGTGGTGGTGTAGATAGGG - Intronic
1129112925 15:73348492-73348514 AAAGTATGCATGTGTAAAAATGG - Intronic
1129551731 15:76458272-76458294 TGTGTGTGCGTGTATATAAAGGG + Intronic
1130009471 15:80138627-80138649 TGAGTGTGACAGTGTAGAAAAGG - Intergenic
1130193601 15:81759235-81759257 TGAGTGTGCTTGGATAAGGATGG + Intergenic
1133373592 16:5265007-5265029 TGTGTGTGTGTGTGTAAAACTGG + Intergenic
1133492692 16:6285924-6285946 TGAGGCTTCTTGTGTAAAAGTGG + Intronic
1133638924 16:7698201-7698223 TGTGTGTGTGTGTGTATAAAGGG + Intronic
1134395333 16:13857483-13857505 TGTGTGTGTGTGTGTATAAAGGG - Intergenic
1134635498 16:15788827-15788849 TGTGTGTGTGTGTGTAAAAGAGG + Intronic
1136562650 16:31049450-31049472 TGTGTGTGTGTGTGTAGAAATGG + Intergenic
1137892727 16:52179489-52179511 TGAGTCTGCTCATGTCAAAATGG + Intergenic
1137978313 16:53049345-53049367 TGTGTGTGTGTGTGTAAACAGGG + Intergenic
1139265373 16:65633651-65633673 TGTGTGTGTGTGTGTGAAAATGG - Intergenic
1139319697 16:66104309-66104331 TGAGTGTGCACATGTGAAAAAGG + Intergenic
1140139581 16:72242861-72242883 TGTGTGTGTTTGTGTGCAAAGGG + Intergenic
1140721026 16:77772358-77772380 TGAATGTGTATGTGTAAAGAAGG - Intergenic
1141158766 16:81615192-81615214 TGTGTGTGCATGTGTAACTATGG + Intronic
1141568135 16:84917140-84917162 TGTGTGTGCATTTGTAAAGAGGG + Intronic
1144752136 17:17656259-17656281 TGTGTGTGTGTGTGTAAAATAGG + Intergenic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1146084303 17:29813363-29813385 TGAGTGAGACTCTGTAAAAAAGG + Intronic
1146633802 17:34489426-34489448 TCAGTTTCCTTATGTAAAAATGG + Intergenic
1146985533 17:37213145-37213167 TGTGTGTGTGTGTGTAAAGATGG - Intronic
1147175861 17:38655796-38655818 TGATTGTGCTTGTGTCCAGAGGG - Intergenic
1148289917 17:46436194-46436216 TGTGTGTGTTTGTGTAGAATTGG + Intergenic
1148312085 17:46653766-46653788 TGTGTGTGTTTGTGTAGAATTGG + Intronic
1148631585 17:49114267-49114289 TAAGTGTACTACTGTAAAAATGG + Intergenic
1150689881 17:67355962-67355984 TGTGTGTGTGTGTGTAGAAATGG - Intronic
1153897452 18:9579533-9579555 TGTGTGTGTGTGTGTAAAATAGG + Intronic
1154195734 18:12265124-12265146 TGTGTGTGCATGTGTGAATATGG + Intronic
1155136196 18:22995145-22995167 TGACTGTGCTTCAGGAAAAAGGG - Intronic
1155387634 18:25297117-25297139 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1155496360 18:26446816-26446838 TGTGTGTGTGTGTGTAGAAATGG - Intergenic
1155804444 18:30149049-30149071 TGAGGATGTTTGTGTGAAAATGG + Intergenic
1155865433 18:30959439-30959461 TGTGTTTGTGTGTGTAAAAAAGG + Intergenic
1155877019 18:31101337-31101359 CGAGTGTCCTTGGGTGAAAAAGG - Intronic
1156693537 18:39737604-39737626 TGTGTGTGTGTGTGTAACAATGG + Intergenic
1157441893 18:47717952-47717974 TGTGTGTGTGTGTGTAAATAGGG + Intergenic
1157912557 18:51631114-51631136 TGTGTGTGCTTGTATTTAAAGGG + Intergenic
1160194258 18:76739369-76739391 TAAGTGTGAGTGTGAAAAAAAGG - Intergenic
1161058973 19:2204934-2204956 GGAGTGTGCATGTGTTTAAATGG + Intronic
1161355038 19:3814309-3814331 TGTGTGTCACTGTGTAAAAAGGG - Intronic
1161657621 19:5525649-5525671 TGTGTGTGCGTGTGTATGAATGG - Intergenic
1162318847 19:9958999-9959021 TGTGTGTGTTTGTGTACAGATGG - Intergenic
1162635095 19:11961915-11961937 TGTGTGTGTGTGTGTAAAAGAGG - Intronic
1163157728 19:15448619-15448641 TGAGTGTGCATGTGTCAATATGG - Intronic
1167996220 19:53404630-53404652 TGTGTGTGTTTGTGTAGAAATGG + Intronic
1168304648 19:55428970-55428992 TGTGTGTGCTTGTGTATGCATGG + Exonic
925248346 2:2405419-2405441 TGAATGTACTTGGGTAAAATCGG - Intergenic
925927962 2:8684090-8684112 TCAGTAGGCTTGTGTCAAAAAGG - Exonic
927293425 2:21426384-21426406 TGAGTGTCCTCATATAAAAATGG + Intergenic
927331348 2:21867221-21867243 TGAATTTGCTTTTGTAAAACAGG - Intergenic
928858935 2:35832475-35832497 TCAGTTTGCTTGTTTAAAGATGG + Intergenic
929358329 2:41053004-41053026 TGAGTGGGCTTCTGTATAACTGG - Intergenic
931788784 2:65645134-65645156 TGAGTGTACTTGTGGGAAAGTGG - Intergenic
932827704 2:74956965-74956987 TGTGTGTGTGTGTGTAGAAATGG + Intergenic
933191440 2:79338301-79338323 TGTGTGTGCTTGTGTGTAAAGGG + Intronic
935842443 2:107128208-107128230 TGTGTGTGTGTGTGTATAAAGGG - Intergenic
936997497 2:118430700-118430722 TCAATGTGCTTGCGTAAGAAAGG + Intergenic
937770066 2:125710278-125710300 TGTGTGTGCATGTGTATACATGG + Intergenic
938327643 2:130422944-130422966 TGAAAGTGCTTGTGTAATAGTGG - Intergenic
938362305 2:130698534-130698556 TGAAAGTGCTTGTGTAATAGTGG + Intergenic
939075098 2:137590520-137590542 TGTGTGTGTTTGTGTATAAGTGG + Intronic
939363263 2:141201210-141201232 TGAGTCTGAATGAGTAAAAATGG + Intronic
939981937 2:148792943-148792965 TGAGTCAGCTAGTGTAACAACGG - Intergenic
940143931 2:150525030-150525052 TGACCGTGAATGTGTAAAAAGGG - Intronic
940422009 2:153489973-153489995 TGTGTGTGTGTGTGTAAAACAGG - Intergenic
940641467 2:156348862-156348884 TGTGTGTGTTTGTATAAAATGGG - Intergenic
941296937 2:163750459-163750481 TGTGTGTGTTGGAGTAAAAAGGG - Intergenic
941467110 2:165841129-165841151 TGTGTGTGTGTGTGTAAAATGGG - Intergenic
943079442 2:183240524-183240546 TTTCTGTGCTTGTTTAAAAATGG - Intergenic
943418971 2:187643365-187643387 TGATTTTTCTTGTGTAGAAAAGG - Intergenic
943525491 2:189011616-189011638 CCAGTGTGTTTCTGTAAAAAAGG - Exonic
943770087 2:191706696-191706718 TGTGTGTGATTGTGGAAGAAAGG - Intergenic
945133599 2:206601275-206601297 TGAGTGTGGTTGTGATGAAAAGG - Intronic
945344096 2:208692492-208692514 TGAGTGAGCTGGTGTTAAATGGG + Intronic
946559360 2:220895539-220895561 TGAATTTGCTTGTTTAAAAGAGG - Intergenic
946734931 2:222744634-222744656 TGAGTGGGCCTGTTTAGAAAGGG + Intergenic
946916391 2:224527121-224527143 TGACTTTGCTTTTGTAAGAAAGG - Intronic
1169587757 20:7105305-7105327 TGTGTGTGTGTGTGTAACAAAGG - Intergenic
1169767610 20:9164936-9164958 TGAGTCTGCCTGTGTAAAAGTGG + Intronic
1170019634 20:11822104-11822126 TGTGTGTGTGTGTGTAAAATAGG + Intergenic
1170298273 20:14853186-14853208 TGTGTGTGTGTGTGTATAAATGG + Intronic
1170530578 20:17287450-17287472 TGTGTGTGTGTGTGTTAAAATGG + Intronic
1171094482 20:22318206-22318228 TGTGTGTGCTTTTGTAAAAATGG + Intergenic
1171565124 20:26176414-26176436 TGTGTGTGTGTGTGTATAAATGG + Intergenic
1173056635 20:39620549-39620571 TGTGTGTGTGTGTGTAAAATTGG - Intergenic
1174138266 20:48395315-48395337 TGGGTGTGCTTGTGTAGACCTGG + Intergenic
1174188309 20:48722550-48722572 TGAGTATGCTTTTTTAAAAAAGG + Intronic
1175175234 20:57107657-57107679 TGTGTGTGCTTGTGTGAATGTGG - Intergenic
1176266911 20:64214392-64214414 TGTGTGTGCATGTGTAAATTTGG + Intronic
1177472580 21:21578014-21578036 TGTGTGTGTGTGTGTAAAACAGG - Intergenic
1177998947 21:28136100-28136122 TGTGTGTGTGTGTGTGAAAAAGG + Intergenic
1179169787 21:38963892-38963914 TGTGTGTGTGTGTGTAAAGATGG + Intergenic
1179496881 21:41777565-41777587 TGTGTGTGTCTGTGTAAAACTGG - Intergenic
1179785345 21:43726872-43726894 TGGGTGTGCTTGTGTGTACATGG + Intronic
1180284723 22:10733626-10733648 TGAGTGGGCTTAGGGAAAAAAGG - Intergenic
1184967578 22:47992166-47992188 TGTGTGTGTTTGTGTAAATAAGG + Intergenic
950073531 3:10171133-10171155 TGCCTGAGCCTGTGTAAAAAGGG + Intronic
950465982 3:13153911-13153933 TGAGTGTGCCTGTGGCAAACTGG + Intergenic
950762716 3:15247628-15247650 TGAGTATCCATGTGTAAAAAGGG + Intronic
951396490 3:22174012-22174034 TGTGTGTGTTTGTGTGTAAATGG - Intronic
952832587 3:37577301-37577323 TGAGTTTTCTTGAGTATAAAAGG + Intronic
955744161 3:62123775-62123797 TCAGTAGGCTTGTGTCAAAAAGG + Intronic
955776073 3:62434817-62434839 TGAGTGTGCCCTTGTAGAAAAGG - Intronic
955958833 3:64318269-64318291 TGAGTGTGCTTTTGTACTACAGG - Intronic
957192287 3:77025031-77025053 TTAGTGTGCTTTCTTAAAAAAGG + Intronic
957379123 3:79401965-79401987 TGTGTGTGCTTATGTAACATTGG + Intronic
957500069 3:81044665-81044687 TGTGTGTGTGTGTGTAAGAAAGG - Intergenic
959475257 3:106803199-106803221 TGTGTGTGTGTGTGTAAAATTGG + Intergenic
960203945 3:114872043-114872065 TGAGTTTGCTTATTTAAAAAGGG - Intronic
960644868 3:119868520-119868542 TGTATGTGATTGTTTAAAAATGG - Intronic
961948462 3:130719723-130719745 TGAGTGTGGTTGTGTGATACAGG - Intronic
963007795 3:140742082-140742104 TGTGTGTGTGTGTGTAAGAAAGG + Intergenic
963778012 3:149459325-149459347 TGTGTGTGTGTGTGTACAAAGGG + Intergenic
964779595 3:160321947-160321969 TGAGCATGCTTGTTTAAGAAAGG + Intronic
965511885 3:169576789-169576811 TGTGTGTGTGTGTGTAAAACAGG - Intronic
965854902 3:173075285-173075307 TGAGGATGGATGTGTAAAAAGGG + Intronic
966040139 3:175474616-175474638 TGATTGTGATTGTGTATACATGG - Intronic
966152630 3:176880999-176881021 GGAGTTTGCTTATGGAAAAATGG + Intergenic
966577425 3:181518310-181518332 TGTGTGTGTGTGTGTAAAAATGG + Intergenic
967439340 3:189488820-189488842 TGAGTGTGTATGTGGAAAACAGG - Intergenic
969101955 4:4776070-4776092 TAAATGTGCTTGTGTATAAGAGG + Intergenic
970174423 4:13324404-13324426 TGAGTGGGCTTAAGCAAAAATGG - Intergenic
973888801 4:55348725-55348747 TGAGTCTGCATGTGTGTAAATGG - Intronic
975477304 4:74838114-74838136 TGTGTGTGTGTGTGTAATAAAGG - Intergenic
976393876 4:84534837-84534859 TGAGGTTGCTTGTGGATAAAAGG + Intergenic
977247576 4:94651267-94651289 TGAGCATGCTTGTTTAAGAAAGG + Intronic
977254487 4:94725814-94725836 TGTGTGTGTGTGTGTAGAAATGG + Intergenic
977368966 4:96110453-96110475 TGAATTTGCTTGTGTAATAATGG + Intergenic
977643205 4:99380872-99380894 TGAGTGTCATTTTGTAAAACTGG - Intergenic
978493372 4:109333094-109333116 TGTGTGTGTTTGTGTGAAATGGG - Intergenic
978536059 4:109764936-109764958 AGAGGTTCCTTGTGTAAAAATGG - Intronic
979090254 4:116474471-116474493 TATGTGTGTTTGTGTAAAATGGG + Intergenic
980891931 4:138824692-138824714 TGTGTGTGCTTGTGTGTATATGG + Intergenic
981357483 4:143806526-143806548 TCAGAGTGATTGTGGAAAAAGGG - Intergenic
981368892 4:143935748-143935770 TCAGAGTGATTGTGGAAAAAGGG - Intergenic
981378690 4:144046002-144046024 TCAGAGTGATTGTGGAAAAAGGG - Intergenic
982076838 4:151746195-151746217 TGTGTGTGTATGTGTAAACATGG + Intronic
982277337 4:153650054-153650076 TGTGTGTGCTTTTACAAAAATGG + Intergenic
983531751 4:168816859-168816881 TGTGTGTGTGTGTGTAGAAAAGG + Intronic
983922418 4:173360131-173360153 TGTGTGTGTGTGTGTAAAAGGGG + Intergenic
984197392 4:176675639-176675661 TGAGAGAGCTTGTTGAAAAACGG - Intergenic
986061179 5:4192596-4192618 TGAGAATGCTCTTGTAAAAAGGG - Intergenic
986271949 5:6239763-6239785 TGAAAGAGCTTGTGTAAGAAAGG - Intergenic
986574583 5:9198805-9198827 TAAGTGTGCTGGAGTAAGAATGG + Intronic
986610345 5:9561001-9561023 TGTGTGTGTGTGTGTAATAAAGG + Intergenic
987902638 5:24032342-24032364 TGTGTGTGTGTGTGTAGAAAGGG - Intronic
989488087 5:42015425-42015447 TGAGTGTGATTTTGTAATAGAGG + Intergenic
989531341 5:42511699-42511721 TGTGTGTGTTTGTGTGAAAGAGG + Intronic
989563148 5:42873864-42873886 TGTGTGTGTGTGTGTAAAAATGG - Intronic
992210484 5:74474932-74474954 TCTGTTTTCTTGTGTAAAAATGG + Intergenic
992892475 5:81216341-81216363 TGTGTGTGTGTGTGTAGAAAGGG - Intronic
993943412 5:94089587-94089609 TGTGTGTGTGTGTGTATAAACGG - Intronic
994352632 5:98764597-98764619 TGTGTGTGTGTGTGTATAAAAGG + Intergenic
995830748 5:116352782-116352804 TGTGATTGCTTGTGTAGAAAGGG + Intronic
998508076 5:142688075-142688097 TGAGTGTGTGTGTTTAAACAGGG - Intronic
999061906 5:148644782-148644804 TTATTGTGCTTGTGTGCAAAGGG + Intronic
1001198857 5:169697938-169697960 TGAGTATGCTTATGAAAAGAGGG + Intronic
1001314850 5:170634602-170634624 GGAGTGTGTGTGTGTAAAGAGGG + Intronic
1002272748 5:178083433-178083455 TGTGTGTGTGTGTGTAAAAGCGG + Intergenic
1003811039 6:9780948-9780970 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1004019206 6:11761241-11761263 TGGGTGTGTTTGTGTAAAAAAGG - Intronic
1004658166 6:17685035-17685057 AGCGTGTGCTGGTGGAAAAATGG + Intronic
1004667273 6:17760074-17760096 TCAGTGTGCTTATGAAACAAAGG + Intronic
1005023179 6:21437029-21437051 TGTGTGTGTGTGTGTAGAAAAGG + Intergenic
1005252108 6:23959112-23959134 TGTGTGTGTTTGTGTCAGAAAGG - Intergenic
1007068360 6:39015868-39015890 TGTGTGTGCTTGTGTGTAAAGGG - Intronic
1008869161 6:56251574-56251596 TGAGTGTGTATGTGAAAAAATGG + Intronic
1008872262 6:56286373-56286395 TGAGTGTATTTGTGTATACATGG - Intronic
1009288464 6:61852993-61853015 TGTGTGTGGTTGTGTGAAGATGG - Intronic
1010154767 6:72779868-72779890 TGTGTGTGTGTGTGTAAAGATGG + Intronic
1010568296 6:77445582-77445604 TGCATGTACTTGTGTAAAATTGG - Intergenic
1011193202 6:84755031-84755053 TGTGTGTGCGTGTGTAGAGAGGG - Intronic
1011844665 6:91548713-91548735 AGAGTGTGCTTGTGTGCTAATGG + Intergenic
1012187597 6:96239276-96239298 TGTGTGTGTTTGTGTGCAAATGG + Intergenic
1012504817 6:99932337-99932359 TTAGAATGCTTCTGTAAAAAAGG - Intronic
1014216769 6:118759649-118759671 TGAGTGTGCCTGTTTAAGATTGG - Intergenic
1015037698 6:128677264-128677286 TGTGTGTGTTTGTGTAATAAAGG + Intergenic
1015209690 6:130683164-130683186 TGTGTGTGTGTGTGTAGAAAGGG - Intergenic
1019189224 6:170240822-170240844 TGAATATGCTCGTATAAAAATGG - Intergenic
1019830832 7:3327954-3327976 TCACTATGCATGTGTAAAAAGGG + Intronic
1020067350 7:5198909-5198931 TAAGTGTGCTTGTCACAAAAAGG - Intronic
1020675512 7:11179246-11179268 ATAGTGTGTTTGTGTGAAAATGG - Intergenic
1021026536 7:15674577-15674599 TGTGTGTGCATGTTTAGAAATGG + Intronic
1021439734 7:20664239-20664261 TGAGTGTGGTTTTCCAAAAAAGG - Intronic
1021928673 7:25557782-25557804 AGAGTGTGGTTATGTAACAAAGG + Intergenic
1021946111 7:25729080-25729102 TGTGTGTGTGTGTGTAAAAGGGG + Intergenic
1022127555 7:27372842-27372864 TGTGTGTGTGTGTGTAAAAGAGG - Intergenic
1023183091 7:37505549-37505571 TGTGTGTGCATGTGCAACAAGGG + Intergenic
1023343320 7:39245877-39245899 TCACTATGCTTGTGGAAAAAGGG - Intronic
1023366587 7:39470577-39470599 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1026842982 7:73681139-73681161 TGAGTGTGAATCTGTAAAAGGGG - Exonic
1027338677 7:77182260-77182282 GGAGAGTGATTGAGTAAAAATGG + Intronic
1027672126 7:81114430-81114452 TGAGAGGGCTTTTATAAAAATGG + Intergenic
1030256464 7:107514322-107514344 TGTGTGTGTGTGTGTAAAATAGG - Intronic
1030336197 7:108329679-108329701 TGATTGTGCTTTTGTGAAGAAGG - Intronic
1030397486 7:109005567-109005589 TGTGTGTGTGTGTGTAAAAGTGG + Intergenic
1030968063 7:116018396-116018418 TGAGTGTGTGTGTTTATAAATGG + Intronic
1031228226 7:119069654-119069676 TGTGTGTACGTGTGTAAATAAGG + Intergenic
1031406009 7:121388228-121388250 TGTGTGTGTGTGTGTTAAAATGG - Intronic
1031663024 7:124450819-124450841 TGTGTGTGCTTGCGTAATACAGG - Intergenic
1032074436 7:128829895-128829917 TGTGTGTGCTTGTGCAGAGACGG - Intergenic
1034457771 7:151180716-151180738 TGTGTGTGCATGTGTATACATGG - Intronic
1036084895 8:5602636-5602658 TGAGTATGCATATTTAAAAATGG + Intergenic
1036246054 8:7117720-7117742 TGTGTGTGTGTGTGTAAAACTGG + Intergenic
1036602159 8:10271348-10271370 TGAGTGTGTTTTTTAAAAAAGGG + Intronic
1037050681 8:14369186-14369208 TGAGTTTGCTTTTGTTATAAAGG - Intronic
1037134242 8:15443367-15443389 TGTGTGTGTGTGTGTAAAGATGG + Intronic
1038248788 8:25883621-25883643 TGTGTGTGCATGTGTAAAAGAGG - Intronic
1038773687 8:30508504-30508526 TTAGTGTGCGTGTGTAAAAATGG + Intronic
1038979722 8:32746132-32746154 TGAGTGTGCTTATGTGCACATGG + Intronic
1041274126 8:56140555-56140577 TGAGTCTGGTTGAGTACAAAGGG + Intergenic
1042618859 8:70681632-70681654 TAAGTCTGATTGTGTAAATATGG + Intronic
1042983819 8:74561142-74561164 TCAGTTTCCTTATGTAAAAATGG - Intergenic
1043913397 8:85891232-85891254 GGACTCTGCTTGTTTAAAAAAGG + Intergenic
1044512789 8:93102550-93102572 TGAGTCTCCTTGTGTAAATATGG + Intergenic
1045273663 8:100682612-100682634 TCAGTGTACTTGTGTTAAAATGG - Intergenic
1046409424 8:113819873-113819895 TTAGTGAGATTGTGGAAAAAGGG - Intergenic
1047522824 8:125608555-125608577 TGAGTGTCCTTGAGTAAGCACGG + Intergenic
1048337155 8:133511514-133511536 TCTTTGTGCTTGTGTAAATATGG - Intronic
1049683041 8:143928181-143928203 TGAGTGTCCTTGTGTTACAGAGG - Intronic
1050168637 9:2792438-2792460 TGCGTGTGTGTGTGTATAAAAGG - Intronic
1050230673 9:3522621-3522643 TGTGTGTGTTTGTGTTTAAATGG - Intronic
1051175368 9:14354803-14354825 TGTGTGTGTGTGTGTAGAAATGG + Intronic
1051237270 9:15014772-15014794 TGACTTGGCATGTGTAAAAATGG + Intergenic
1052559919 9:30071827-30071849 TTGGTGAGGTTGTGTAAAAACGG + Intergenic
1053263926 9:36696718-36696740 TGTGTGTGTGTGTGTACAAAGGG - Intergenic
1053830481 9:42074785-42074807 TCAGTGTGGTTGTTCAAAAAAGG + Intronic
1054600078 9:67112670-67112692 TCAGTGTGGTTGTTCAAAAAAGG - Intergenic
1054821742 9:69528736-69528758 TGTGTGTGTGTGTGTGAAAATGG - Intronic
1056254467 9:84784536-84784558 TGAGTGTGCCTGTGTACATTTGG + Intronic
1056913730 9:90726832-90726854 TGTGTGTGTTTCTGTAAAACTGG + Intergenic
1057414239 9:94847120-94847142 TGTGTGTGTGTGTGTACAAAGGG - Intronic
1057417241 9:94875604-94875626 GGAGTGTGCTTCTATAACAATGG - Intronic
1058242287 9:102579794-102579816 TGTGTGTGTCTGTGTAATAATGG + Intergenic
1058324128 9:103674266-103674288 TCAGTGTGCTTGTGAACAAATGG - Intergenic
1058363302 9:104176394-104176416 TCAGTGAGCCTGTGTAATAAAGG - Intergenic
1062187521 9:135226497-135226519 TGAGTGTGCATGTGTGAGCATGG - Intergenic
1185573927 X:1155383-1155405 TGTGTGTGTCTGTTTAAAAAAGG + Intergenic
1185776541 X:2807830-2807852 TGCATGTGCTTGTGTATGAATGG + Intronic
1186016975 X:5208005-5208027 TGAGTGTTCATGAGTAAGAATGG - Intergenic
1186284348 X:8027442-8027464 TGAGTGGGCTGGTGGATAAATGG - Intergenic
1186293386 X:8123041-8123063 TGTGTGTGTGTGTGTAAATAAGG + Intergenic
1186522846 X:10221109-10221131 TGAGGGAGGTTGAGTAAAAAGGG + Intronic
1186723145 X:12327465-12327487 TGAGTTTGTTTGAGTAATAATGG + Intronic
1187045242 X:15641663-15641685 TGTGTGTGTGTGTGTAAACAGGG + Intronic
1187617941 X:21018535-21018557 TGTGTGTGCGTGTGTGAAGAAGG - Intergenic
1188537445 X:31213351-31213373 TGACTGTGCCCGGGTAAAAATGG - Intronic
1189871728 X:45391295-45391317 TGTGTGTGCTTGAGAAAAATGGG + Intergenic
1190905906 X:54727901-54727923 TGTGTGTGTGTGTGTATAAATGG - Intergenic
1192899016 X:75474566-75474588 TGTGTGTGTGTGTGTATAAAGGG - Intronic
1194073610 X:89360190-89360212 TGAGTGTGTTTGTCAAAAAAGGG + Intergenic
1194120234 X:89952719-89952741 TGAGTGTGTTTGTATTTAAAAGG + Intergenic
1194825183 X:98553286-98553308 TGAATGTACTTATATAAAAAAGG - Intergenic
1195848051 X:109249446-109249468 TGTGTGTGTGTGTGTAAAAAGGG + Intergenic
1196268319 X:113679553-113679575 TGAGTGAGTTTTTGTATAAAGGG + Intergenic
1197474171 X:126899790-126899812 TAAGGGTGCTAGTGTAAAAGTGG + Intergenic
1198320550 X:135515254-135515276 TGAGTATGCATGTGGGAAAAAGG - Intergenic
1199012321 X:142771896-142771918 TGTGTGTGTGTGTGTAGAAATGG + Intergenic
1199944578 X:152655043-152655065 TGTGTATGCTTGTGTACACATGG + Exonic
1200728994 Y:6711755-6711777 TGAGTGTGTTTGTCAAAAAAGGG + Intergenic
1201677207 Y:16599858-16599880 TGAATGTCTTTGTGAAAAAATGG - Intergenic