ID: 1071688496

View in Genome Browser
Species Human (GRCh38)
Location 10:87789310-87789332
Sequence ATAAGCTATCTCGTGAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071688495_1071688496 25 Left 1071688495 10:87789262-87789284 CCATATAGTTTTGGCAATGCATT 0: 1
1: 0
2: 0
3: 18
4: 162
Right 1071688496 10:87789310-87789332 ATAAGCTATCTCGTGAAATTTGG No data
1071688494_1071688496 26 Left 1071688494 10:87789261-87789283 CCCATATAGTTTTGGCAATGCAT 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1071688496 10:87789310-87789332 ATAAGCTATCTCGTGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071688496 Original CRISPR ATAAGCTATCTCGTGAAATT TGG Intronic
No off target data available for this crispr