ID: 1071688551

View in Genome Browser
Species Human (GRCh38)
Location 10:87790108-87790130
Sequence GTATTTTAACATGTAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 494}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071688551 Original CRISPR GTATTTTAACATGTAAATAC AGG Intronic
905047803 1:35021889-35021911 GTATTTTAACATTAAAAAAAAGG - Intronic
905051940 1:35059323-35059345 TTATTGCAACATGTATATACAGG + Intergenic
905696693 1:39979846-39979868 GCCTTTTAATATGCAAATACAGG - Intergenic
907012907 1:50979398-50979420 GTCTTTTAACATGAAAATAATGG + Intergenic
907568258 1:55457599-55457621 GCCTTTTAATATGCAAATACAGG + Intergenic
909314907 1:74203739-74203761 GTTGTTTAAAATGTAGATACAGG + Intronic
909362167 1:74774382-74774404 TTTTTTTAAAATGTAATTACTGG - Intergenic
909682569 1:78309389-78309411 GTATTATAACATTTAAATTAAGG + Intronic
909800299 1:79797636-79797658 GCCTTTTAATATGTAAATACAGG + Intergenic
909900694 1:81131096-81131118 GTATTTTAAATTTTAAATATGGG - Intergenic
910139832 1:84014943-84014965 GTATTTTTAAATGTATATAGTGG + Intergenic
910376982 1:86583156-86583178 GTATTTTAACATGGTAGTTCAGG - Intergenic
912110879 1:106341249-106341271 GTATTTCAACATATAAATTTTGG - Intergenic
915715967 1:157945500-157945522 GTATTTCAACATATAAATTCAGG - Intergenic
915717919 1:157961927-157961949 CTATATTAACATGAATATACTGG - Intergenic
916773186 1:167934175-167934197 GTATTTTAAGCAGTAATTACAGG + Intronic
916933886 1:169607560-169607582 ATATTTTAACTTGTAAAGATAGG + Intronic
917421641 1:174869682-174869704 GTATTTCAACATGTGAATTTTGG - Intronic
918766470 1:188491365-188491387 ATATATTAACATGCAAATATAGG + Intergenic
918773760 1:188600937-188600959 GTTTTTTAAAATGTAAGTAAAGG - Intergenic
919347239 1:196399697-196399719 GGATTTCAACATGTAAATTTGGG - Intronic
919413672 1:197278976-197278998 CTATTTTCACATGTAGATAGAGG + Intronic
919577850 1:199334272-199334294 GTATTTTAAAATTAAAATAGTGG - Intergenic
919637614 1:200018088-200018110 GTATTTAAATATTTAAATATTGG - Intergenic
920911081 1:210217422-210217444 GGACTTTAACATATAAATATTGG - Intergenic
921410364 1:214829859-214829881 GGATTTCAACATATAAATTCTGG + Intergenic
921918514 1:220641241-220641263 GAATTTTAACATGTGAATTTTGG - Intronic
922849881 1:228723449-228723471 GTCTTTTAATATGCAAATGCAGG + Intergenic
922974590 1:229773379-229773401 GTATTTTAAGAAGAAAATGCTGG - Intergenic
923070309 1:230558374-230558396 GGATTTCAACATGTAAATTTCGG + Intergenic
923168961 1:231395431-231395453 GTATTTTAAGTTCTAAAAACTGG + Intronic
1064145846 10:12825833-12825855 TTTTTTTAACATGTAATCACTGG + Intronic
1064930298 10:20618291-20618313 GTATTTTAAAAAATAAATAGAGG - Intergenic
1065096408 10:22285075-22285097 GTTTTAAAACATGTAAATCCAGG + Intergenic
1065179764 10:23113195-23113217 TTCTTTTAACAAGTAAATGCAGG + Intronic
1066110059 10:32187834-32187856 GCTTTTTAATATGCAAATACAGG + Intergenic
1066471276 10:35700697-35700719 GTCTTTTAGTATGCAAATACAGG - Intergenic
1067005149 10:42653851-42653873 TTGGTTTAACATGTAAATAGGGG - Intergenic
1068415810 10:56720853-56720875 CTATATTAACATGTCAATAAAGG + Intergenic
1068522488 10:58093229-58093251 GTCTTTTAATATGCAAATGCAGG + Intergenic
1068748910 10:60568740-60568762 GAATTTTAACATATAAATTTGGG - Intronic
1069197093 10:65564994-65565016 GTATATTAAAATGTAAATAGTGG + Intergenic
1069745048 10:70709807-70709829 CTCTTTTAACATTTAAAAACTGG - Intronic
1070199656 10:74191401-74191423 TTATTTTAAAATATAAAGACAGG + Intronic
1070545522 10:77449410-77449432 GTATTCACACATGTAAATGCTGG + Intronic
1071543137 10:86506472-86506494 ATATTTTAAAATGTCAATATTGG + Intronic
1071688551 10:87790108-87790130 GTATTTTAACATGTAAATACAGG + Intronic
1072795635 10:98352374-98352396 GTATTTTAAAATGTTCATAAAGG + Intergenic
1073838515 10:107471519-107471541 GTTCTTTAATATGCAAATACAGG + Intergenic
1073981320 10:109157006-109157028 CTATTTTAACATGAAACAACAGG + Intergenic
1075002753 10:118810122-118810144 GATTTTTCACCTGTAAATACGGG + Intergenic
1075372234 10:121947031-121947053 GTATTTCAACATTTCAACACTGG + Intergenic
1076233766 10:128847325-128847347 GTACTTCAACATGAAAGTACTGG + Intergenic
1077813708 11:5664855-5664877 GGATTTAAATATGGAAATACAGG + Exonic
1078867118 11:15307981-15308003 GTGGGTTAACATGTAAATAAGGG + Intergenic
1078868739 11:15324451-15324473 CTATTTTAACATGTTAACAGAGG - Intergenic
1078978988 11:16510232-16510254 GTATGTTTAAATGTAAATTCAGG - Intronic
1080631914 11:34085462-34085484 TTATTTTAGGATGTAAACACAGG + Intronic
1081122077 11:39279193-39279215 GTTTTTAAACATGTAAGTCCAGG - Intergenic
1081170504 11:39864024-39864046 TTATTTTAAAATGAAAATTCTGG - Intergenic
1081952570 11:47057677-47057699 GGATTCTGACCTGTAAATACTGG - Intronic
1082676780 11:56114736-56114758 TTATTTTAACATTTAAGTTCAGG + Intergenic
1084257546 11:67953411-67953433 GCATTTTAACATGGAGATTCTGG + Intergenic
1084815227 11:71641830-71641852 GCATTTTAACATGGAGATTCTGG - Intergenic
1084914846 11:72421064-72421086 GCATTTTAATATGCAAATGCAGG - Intronic
1085839173 11:79990972-79990994 GGATTTTAACATGTAAATTTTGG - Intergenic
1085901210 11:80701937-80701959 GGATTTTAACATATAAATTTGGG + Intergenic
1085944773 11:81255490-81255512 GCATTTTAACATATAAAATCTGG - Intergenic
1086222849 11:84470828-84470850 GTATTTTATTCTGTAAGTACTGG + Intronic
1087033975 11:93737483-93737505 GCATTTTAAAATGTAAAAACAGG + Intronic
1087411882 11:97801335-97801357 GCATTTTAAAATGTAAACAAAGG - Intergenic
1087648248 11:100833001-100833023 GTTTTGTATCCTGTAAATACAGG + Intronic
1087657578 11:100943233-100943255 CTATTATATCATGTATATACTGG + Intronic
1087822507 11:102728467-102728489 GGATTTCAACATGTAAATTTGGG - Intergenic
1089037317 11:115408190-115408212 TTATTTTTACATGTGAACACTGG + Intronic
1091082678 11:132686433-132686455 GTATATTAACTTGCAAATAATGG + Intronic
1091106724 11:132927128-132927150 TTATTTGAATATGTAACTACTGG + Intronic
1091275802 11:134349003-134349025 GGATTTCAACATGTAAATTTTGG + Intronic
1091321009 11:134651162-134651184 GTATTTTTAGATGTAAGTAAAGG - Intergenic
1092427775 12:8388207-8388229 GCATTTTAACATGAAGATTCTGG + Intergenic
1092429045 12:8395188-8395210 GCATTTTAACATGAAGATTCTGG + Intergenic
1092487673 12:8915905-8915927 GTATTTTCACATGTGAATGTAGG + Intronic
1092575994 12:9783122-9783144 GTCTTTTAATATGCAAATACAGG + Intergenic
1092576575 12:9790568-9790590 GTCTTTTAATATGCAAATGCAGG - Intergenic
1092813085 12:12289379-12289401 GTATTTTAACATATAATTGTTGG - Intergenic
1093197533 12:16146394-16146416 GTATTTTTACATGAAAAGAAAGG - Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1094289450 12:28830661-28830683 GTCTTTTAATATGCAAATACAGG - Intergenic
1094567096 12:31609411-31609433 GTATTTTAAAATGTTATCACTGG + Intergenic
1095133145 12:38567173-38567195 GAATTTTAATATGTAAATTCGGG - Intergenic
1095678500 12:44947894-44947916 ATATTTTAACATGTATATTTTGG - Intergenic
1095685452 12:45028470-45028492 TTATTTTAACATGTAGATCTTGG - Intronic
1097507372 12:60492282-60492304 GTATCTTAATATGGAAATAAAGG + Intergenic
1097570231 12:61323195-61323217 CTATTTTAACATTTTAATAATGG - Intergenic
1097578711 12:61427080-61427102 TTATTTTAGCATGTTAATCCTGG - Intergenic
1098247964 12:68539954-68539976 GGATTTAATCATGAAAATACTGG - Intergenic
1098505362 12:71243152-71243174 GAATTTTCACATGTAAAAAGAGG - Intronic
1099278000 12:80602705-80602727 GTATTTCAACATCTAAATTTTGG + Intronic
1099359036 12:81675443-81675465 TTATTTTAACATGTAAATAATGG + Intronic
1099744079 12:86679540-86679562 GGATTTTAACATATAAATTTTGG - Intronic
1100784579 12:98065471-98065493 GTATTTTCTCATCTAAAGACAGG + Intergenic
1101480349 12:105090555-105090577 GCCTTTTAATATGCAAATACAGG - Intergenic
1102108578 12:110346550-110346572 GAATTTTCACATGAACATACTGG + Exonic
1102907732 12:116689796-116689818 GTTTTTTAAGGTCTAAATACCGG + Intergenic
1105681550 13:22733454-22733476 GTAATATAAAATGTAAATAATGG + Intergenic
1106042562 13:26107406-26107428 GGATTTTAACAGGTAGATATGGG - Intergenic
1107753611 13:43595650-43595672 GTATTTTCATAGGAAAATACTGG + Intronic
1108434290 13:50386535-50386557 GAATTTTAATATGTATATACAGG - Intronic
1108576518 13:51796034-51796056 GTTTTTTAACATGTATTTAAGGG - Intronic
1109285755 13:60406455-60406477 ATATTTTAAAAAGTAAAAACAGG - Intronic
1109395581 13:61754379-61754401 GTATTTCAACTTTTAAATTCGGG + Intergenic
1109547873 13:63851219-63851241 TTATTTTGACATGTAAATTTGGG + Intergenic
1109550267 13:63887411-63887433 GTATTTTAACATATGAATTTTGG - Intergenic
1109613460 13:64797369-64797391 GTATTTTACCATAAAAATAGAGG - Intergenic
1109667250 13:65555402-65555424 TTATTAGAACATGTAAATAATGG - Intergenic
1110598668 13:77346849-77346871 TTATTTGACCATGTCAATACAGG + Intergenic
1111251628 13:85608711-85608733 GCCTTTTAATATGTAAATGCAGG - Intergenic
1111852566 13:93595182-93595204 GTATTTTTACATGTATATTAGGG + Intronic
1111923929 13:94442586-94442608 ATATTTTGACAAGTATATACAGG - Intronic
1111979125 13:94998606-94998628 GAATTATAACATTAAAATACTGG + Intergenic
1112247153 13:97745674-97745696 GGATTTTAACATGTGAATTTGGG - Intergenic
1112346185 13:98591819-98591841 GAATTTTAATAAGTAAATACTGG - Intergenic
1114852648 14:26399828-26399850 GTATTTTAAAATGTACTTAAAGG + Intergenic
1114966037 14:27961220-27961242 ATATTTTCATATGTAATTACAGG + Intergenic
1115069683 14:29305978-29306000 ACATTTTAAAAGGTAAATACTGG - Intergenic
1115099311 14:29678776-29678798 GCATTTTAACATATATATGCAGG + Intronic
1115195792 14:30797985-30798007 GTATTCTAATAGGAAAATACAGG + Intergenic
1115345695 14:32340967-32340989 GGATTTTAACATATAAATTTTGG + Intronic
1115616128 14:35096397-35096419 GTATTTAAACAAGTAAATTTTGG + Intronic
1115627653 14:35210270-35210292 GTTTTTTGACAAGTAATTACTGG - Intronic
1116225346 14:42143917-42143939 GTATTTTTACATACAAATACAGG - Intergenic
1116336409 14:43663174-43663196 GTATGTTCACATATAAATATTGG + Intergenic
1116589453 14:46752277-46752299 ATATTTTAACATGAAAACATTGG + Intergenic
1117509019 14:56430013-56430035 GTCTTTTAACCTATAAATAAAGG - Intergenic
1117644187 14:57833956-57833978 TTATTTTAACATGTGAAGAGAGG - Intronic
1118453680 14:65926702-65926724 GCCTTTTAATATGCAAATACAGG - Intergenic
1118513618 14:66503920-66503942 GTATTTTACCATTTAAAAAATGG + Intergenic
1118559137 14:67059206-67059228 ACATTTTTACATTTAAATACAGG - Intronic
1120477568 14:85007688-85007710 GTACTTCAACATGTAAACATGGG + Intergenic
1120491291 14:85181599-85181621 GTATTATAATATTTAAATAAAGG + Intergenic
1121853195 14:97242516-97242538 GGATTTTAACATATGAATTCGGG + Intergenic
1122528327 14:102406236-102406258 GTATTTTAACATTAAAAAATTGG + Intronic
1122700869 14:103588171-103588193 TTAATTTCACCTGTAAATACAGG - Intronic
1122709102 14:103642334-103642356 GAATTTTAACATGTGAATTGGGG + Intronic
1124271045 15:28281001-28281023 GTTTTGTAACATGAAAATAATGG - Intronic
1124639540 15:31388438-31388460 GTATTTTTACATGGAGAGACAGG - Intronic
1126203237 15:46013667-46013689 CGATTTAAACATGTAAATACAGG - Intergenic
1126810379 15:52396856-52396878 GGATTTTAACAGCTAAAGACAGG + Intronic
1126821634 15:52510284-52510306 TTATTTTAAAATGTATATATTGG - Intronic
1127542345 15:59953039-59953061 GGATTTCAACATGTAAATTTTGG + Intergenic
1128807581 15:70542951-70542973 ATATTTTAAGATGGCAATACCGG + Intergenic
1130706356 15:86236873-86236895 GCCTTTTAATATGCAAATACAGG + Intronic
1131564087 15:93470180-93470202 GTCTTTTAATATGCAAATGCAGG - Intergenic
1131713247 15:95079300-95079322 GCATTATAACAATTAAATACTGG - Intergenic
1133697567 16:8279572-8279594 AAATTTTAACATATAGATACTGG + Intergenic
1135242724 16:20823229-20823251 GTATTTTATCATGGAATTATTGG + Intronic
1135877929 16:26221611-26221633 ATTTTTTAACATGTAAAAATAGG - Intergenic
1138021901 16:53491745-53491767 GTCATTTATCATTTAAATACCGG + Exonic
1140080951 16:71746768-71746790 GTATTTTAACCAGAAAATTCTGG - Intronic
1140231066 16:73117686-73117708 GGATTTTAACATGTGAATTTAGG - Intergenic
1142785401 17:2218071-2218093 ACATTTAAACATTTAAATACAGG - Intronic
1144012342 17:11161662-11161684 GCTTTTTAATATGCAAATACAGG - Intergenic
1144469411 17:15524114-15524136 GGAATTTATCATGTAAAGACGGG - Intronic
1144926944 17:18819563-18819585 GGAATTTATCATGTAAAGACGGG + Intergenic
1145833622 17:27937289-27937311 GCCTTTTAATATGCAAATACAGG - Intergenic
1147524740 17:41211614-41211636 ATACTTTTCCATGTAAATACTGG - Intronic
1148014537 17:44511918-44511940 GCCTTTTAATATGCAAATACAGG - Intergenic
1149155154 17:53620304-53620326 GTTTTTTAAAAAGTAAATATAGG - Intergenic
1149335756 17:55634024-55634046 GGATTTCAACATGTAAATTTTGG + Intergenic
1149632695 17:58139995-58140017 CTATTTTAACATGGGAATTCTGG + Intergenic
1150053796 17:61992303-61992325 CTATTTTTATATGTAAAAACAGG + Intronic
1150271730 17:63871187-63871209 GAATTCTAACATTTAAACACTGG - Intergenic
1150275277 17:63894084-63894106 GAATTCTAACATTTAAACACTGG - Intergenic
1151506647 17:74532249-74532271 GCCTTTTAATATGCAAATACAGG - Intergenic
1152413159 17:80140726-80140748 GTATATTAAGATGTTAATGCTGG - Intronic
1152971499 18:166226-166248 GTATTTGATGCTGTAAATACAGG + Intronic
1153602170 18:6791504-6791526 GTATTTAAATATGTAAACATTGG + Intronic
1155606338 18:27610443-27610465 GTATTTTAACATGATTATATGGG + Intergenic
1155838702 18:30621130-30621152 GTAATAGAATATGTAAATACTGG - Intergenic
1156871464 18:41950559-41950581 TAATTTTAACATGTAAATTTTGG + Intergenic
1156982681 18:43309368-43309390 GTATTTTAGCATGTAAAATTTGG + Intergenic
1157888751 18:51394385-51394407 GGATTTTAACATGTGAATTTTGG - Intergenic
1158218542 18:55126246-55126268 GAATTTCAACATATGAATACAGG + Intergenic
1158677190 18:59530876-59530898 CTATTTTGACATCTTAATACTGG + Intronic
1159985498 18:74836315-74836337 GATTTTAAACATGTAAATAAAGG - Intronic
1164286027 19:23818636-23818658 GTGATTTAGCATGTAAATAGGGG + Intronic
1164397276 19:27877218-27877240 GCATCTTAACATGCAAATGCAGG - Intergenic
1165082218 19:33314639-33314661 TTATTTTAAAAAGTAAACACAGG + Intergenic
1165112490 19:33510529-33510551 GTCTTTTAATATGCAAATGCAGG + Intronic
1168484646 19:56750679-56750701 CTTTTTTAAAATGTAGATACAGG + Intergenic
1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG + Intronic
926151404 2:10427581-10427603 TTATTTTATCATTTTAATACCGG - Exonic
926442222 2:12901801-12901823 GTATCATCCCATGTAAATACAGG - Intergenic
927407681 2:22790516-22790538 GGATTTTGAAATGTAGATACTGG - Intergenic
927409613 2:22809147-22809169 GCATTCTCATATGTAAATACTGG + Intergenic
927904454 2:26847300-26847322 GTATTTAAACATGAAGAAACAGG + Intergenic
927984831 2:27402057-27402079 GTATTTGAAAATGTGTATACAGG - Intronic
929287098 2:40147714-40147736 GAATGTTAACATGTATATAAAGG + Intronic
929365314 2:41147758-41147780 GAATTTTAACATATAAATTTGGG + Intergenic
929881226 2:45838828-45838850 GTATTGTTACATGTAATTCCAGG - Intronic
930193642 2:48486328-48486350 GGTTTTTAACTGGTAAATACAGG + Intronic
930447699 2:51496132-51496154 CTTATTTAACATGTATATACAGG - Intergenic
930602539 2:53458626-53458648 GGATTTCAACATATAAATATTGG - Intergenic
931827458 2:66016556-66016578 GTATTTCAACATGTAAATGCTGG - Intergenic
932926952 2:75987553-75987575 GGATTTCAACATATAAATTCTGG + Intergenic
933295036 2:80480127-80480149 TTATATTAACATGCAAATAATGG - Intronic
933492539 2:83006246-83006268 GGATTTTAAAATGTATATTCAGG + Intergenic
934028982 2:88024677-88024699 GCCTTTTAACATGCAAATGCAGG + Intergenic
934131491 2:88953227-88953249 GTGTTTTAATATGCAAATGCAGG - Intergenic
934166128 2:89296046-89296068 GCCTTTTAATATGCAAATACAGG + Intergenic
934201147 2:89886410-89886432 GCCTTTTAATATGCAAATACAGG - Intergenic
934222251 2:90095714-90095736 GACTTTTAATATGCAAATACAGG + Intergenic
934590097 2:95541047-95541069 ATATTTTAACATGTAAAATAAGG - Intergenic
935393061 2:102574114-102574136 GTATTTTTTCATATACATACTGG + Intergenic
935555700 2:104507529-104507551 GTATTTCAGCATAAAAATACAGG - Intergenic
935726326 2:106027135-106027157 ATATTTTCTCATGTAAAAACAGG - Intergenic
936229611 2:110688666-110688688 GCCTTTTAACATGCAAATGCAGG - Intergenic
936279637 2:111126189-111126211 GTATTTTTTAATGTAAAGACAGG + Intronic
936376227 2:111943560-111943582 GCATTTCAACATGTAAACACCGG + Intronic
937007419 2:118530020-118530042 GTTTTTTCACATGTAAATAAGGG - Intergenic
937146730 2:119653082-119653104 GTGGTTTAAAATATAAATACCGG + Intronic
938794046 2:134703702-134703724 TTATTTACACAAGTAAATACAGG + Intronic
939112831 2:138028774-138028796 GCTTTTTAATATGTAAATGCAGG + Intergenic
939341435 2:140900177-140900199 ATAATTCAACATTTAAATACAGG - Intronic
939946512 2:148417623-148417645 GTGTTTTAACTTTTTAATACTGG + Intronic
940093064 2:149943832-149943854 GGATTTCAACATGTAAATTTGGG - Intergenic
940697643 2:156999700-156999722 GCATTTTAACCTCTAAACACAGG + Intergenic
940829145 2:158448642-158448664 CAATTTTAAAATGGAAATACAGG - Intronic
941153585 2:161946574-161946596 GTATTTTTACATTTCAAAACAGG - Intronic
941312843 2:163955570-163955592 GAATTTTAACATATAAATTTTGG + Intergenic
941364232 2:164590813-164590835 GCATTTTAATATGAAAATAATGG - Intronic
942122115 2:172788205-172788227 GGATTTTAACATATAAATTTCGG + Intronic
942644794 2:178098224-178098246 GTATTTAAACATCCAAAAACTGG + Intronic
942885090 2:180913574-180913596 GTATTTTAACTTTTAAGTTCAGG + Intergenic
942993451 2:182231613-182231635 CTGTTTTAAGATGTAAATATCGG + Intronic
943054784 2:182962583-182962605 ATATTTTAACATTTAAGAACTGG - Intronic
943208431 2:184930843-184930865 GTTTTTTAAAATGTAACTAGTGG + Intronic
943618374 2:190119443-190119465 GTCTTTTAACACGCAAATGCAGG + Intronic
943911483 2:193573467-193573489 GTATTTTTACATGTAACTTATGG + Intergenic
944014874 2:195023828-195023850 TAATTTTAAAATGCAAATACAGG - Intergenic
944045280 2:195404091-195404113 TTATTTTAATATTTAAAGACTGG + Intergenic
944386109 2:199166644-199166666 GTTTGTTAATATGTGAATACTGG + Intergenic
944477887 2:200125728-200125750 GCCTTTTAATATGCAAATACAGG + Intergenic
944822638 2:203445999-203446021 GTAATGTAACATGTTAATAATGG - Exonic
946638827 2:221760752-221760774 GGATTTCAACATATAAATATAGG + Intergenic
946695602 2:222355331-222355353 GTATTTTAACATACAAATTTAGG + Intergenic
1173030290 20:39351659-39351681 GTTTGTTAGCATGTAATTACTGG - Intergenic
1174056933 20:47804446-47804468 GTCTTTTAATATGCAAATACAGG - Intergenic
1174867467 20:54151297-54151319 GCCTTTTAGCATGTTAATACAGG + Intergenic
1174924671 20:54745751-54745773 GCATCTTTTCATGTAAATACTGG - Intergenic
1175679234 20:60973394-60973416 GTAGTTAAAGATGTAAATTCTGG + Intergenic
1176967585 21:15228797-15228819 GTATTTTAAGTTGTAAATTCTGG - Intergenic
1177139862 21:17346074-17346096 GTATCTTAATATATAAATATTGG - Intergenic
1177675165 21:24287840-24287862 ATATTTCAACATGTAAATTTTGG + Intergenic
1177897161 21:26867052-26867074 GGATTTTAACATATAAATTTTGG + Intergenic
1179161818 21:38905588-38905610 GTCTTTTAATATGCAAATACAGG + Intergenic
1179708990 21:43201171-43201193 GGAATTTAACATGTAAATTTTGG + Intergenic
1180642267 22:17308680-17308702 ATATTTAAAAATTTAAATACAGG + Intergenic
1181691873 22:24567435-24567457 TTTTTTTAACATGTAAAGATGGG + Intronic
1183017659 22:35002778-35002800 GTAATTAAACAGGTAAATCCTGG - Intergenic
1183282690 22:36940844-36940866 GCATTTTAATATGCAAATGCAGG + Intergenic
949101684 3:153192-153214 GTATTTTAACACCAACATACGGG + Intergenic
949375247 3:3381957-3381979 GAATTATAACATGTATATAATGG - Intergenic
949669170 3:6378432-6378454 GTCTTTTAATATGCAAATACAGG - Intergenic
949749821 3:7338870-7338892 GCCTTTTATCATGTAAATTCTGG + Intronic
949819557 3:8101409-8101431 TTATTTTAACATGAAAAAATAGG + Intergenic
951193671 3:19800646-19800668 ATATTTCAACATGTAAATTTTGG - Intergenic
952071813 3:29646565-29646587 GTATGTCTACATTTAAATACTGG + Intronic
952929992 3:38352495-38352517 GTGTTTTTACATGGAAATATAGG - Intronic
953573825 3:44096765-44096787 GTAGACTAAGATGTAAATACAGG + Intergenic
953594360 3:44294880-44294902 GAATTTTAACATTTATATTCAGG + Intronic
954043969 3:47913305-47913327 ATATTATAATATGTAAATAGTGG + Intronic
954870527 3:53764351-53764373 GTATATTTACATGAAAATTCTGG + Intronic
955562885 3:60211909-60211931 GTACTTTAATATGTATATATTGG - Intronic
955638792 3:61059540-61059562 GTATTTTCATTTGTAAATAATGG + Intronic
955724153 3:61914746-61914768 TAATTTTAACATGTAGAAACAGG + Intronic
955979164 3:64507517-64507539 GTATTTCAACATACAAATTCTGG - Intergenic
956003576 3:64754546-64754568 TTATTTTACCATGTAACCACAGG + Intergenic
957072479 3:75577906-75577928 GCATTTTAACATGGAGATTCTGG + Intergenic
957185283 3:76933961-76933983 GTGGTTCAACATGCAAATACTGG - Intronic
957318050 3:78593306-78593328 GAATTTTAACATATGAATTCAGG + Intergenic
957682426 3:83454163-83454185 GTATATTAAAAAGAAAATACAGG - Intergenic
957701392 3:83719416-83719438 GTATTCAAACCTGTAAGTACTGG - Intergenic
957874357 3:86126587-86126609 ATATTTTACCATGTATATCCAGG - Intergenic
957910504 3:86615047-86615069 ATGTTTTAACATGTAAATTCTGG + Intergenic
958066233 3:88547013-88547035 GTAATTTAAGTTGTAAATTCTGG - Intergenic
958431986 3:94050638-94050660 ATATTTTAAAATGTAATTATAGG - Intronic
959341326 3:105135264-105135286 GACTTTTAACATGCAAATGCAGG - Intergenic
960485416 3:118246041-118246063 GTAGTTTAAGATTTAAATTCAGG - Intergenic
960541598 3:118867782-118867804 GAATTTTAACATATAAATTTTGG + Intergenic
960704694 3:120470512-120470534 GGACTTTAACATATAAATATTGG + Intergenic
961281596 3:125768869-125768891 GCATTTTAACATGGAGATTCTGG - Intergenic
961872763 3:130000723-130000745 GCATTTTAACATGGAGATTCTGG + Intergenic
962440608 3:135412038-135412060 GGATAATAATATGTAAATACTGG + Intergenic
962651373 3:137496801-137496823 GTTTTTTGACATTTTAATACTGG + Intergenic
962719015 3:138155214-138155236 GTATCTTAAAATGCAAACACAGG - Intergenic
962910716 3:139847133-139847155 GAACTTTAACATGTAAATTTTGG - Intergenic
963886376 3:150587424-150587446 GCATTTTAACATCTAAATTTGGG + Intronic
964568918 3:158091090-158091112 GTAGTTTAAAAGGTAAATAATGG + Intergenic
964776375 3:160282620-160282642 TTTTTTTTAAATGTAAATACTGG + Intronic
964868172 3:161284622-161284644 GTATTTTAATATGCAAATGTTGG - Intergenic
965822050 3:172694177-172694199 GTTGTATAACATTTAAATACAGG - Intronic
965991858 3:174828724-174828746 GGTTTATAACATGTAAATTCAGG - Intronic
966286204 3:178298424-178298446 GAATTTAAACATGTAAAAAGTGG + Intergenic
966288925 3:178331828-178331850 ATATTTCAAAATGTAAATATAGG + Intergenic
966601072 3:181775614-181775636 GTATTTTAAGAGGTAAATATGGG - Intergenic
967542603 3:190684880-190684902 GCCTTTTAATATGCAAATACAGG - Intergenic
968280926 3:197476156-197476178 GTATTTGGACATGTAGAGACAGG - Intergenic
968320289 3:197762144-197762166 GTATTTCAACATGTGAATTTTGG + Intronic
969016073 4:4105215-4105237 GCATTTTAACATGGAGATTCTGG + Intergenic
969578781 4:8051816-8051838 GTCTTTTAATATGCAAATGCAGG - Intronic
969956526 4:10896813-10896835 GTATATTAATATGTTAATATTGG + Intergenic
970197751 4:13569634-13569656 GTATATAAACATGTAAAAATAGG - Exonic
970897546 4:21120926-21120948 GAATTTCAACATGTAAATTCTGG + Intronic
971949348 4:33324580-33324602 GTATATTAAGCTGTAAACACTGG + Intergenic
972067025 4:34960582-34960604 ATATTTAACCATGTAAATAATGG - Intergenic
972216316 4:36900705-36900727 GCATTTTAATATGCAAATGCAGG - Intergenic
972733477 4:41817640-41817662 GAGTTTTAAGATGTAAATATGGG + Intergenic
972908223 4:43778250-43778272 TTATTTTAACTTTTAAATGCAGG + Intergenic
972974365 4:44615477-44615499 GCATTTTAAAATGTGAACACTGG - Intergenic
973113594 4:46426524-46426546 TTTTTTTAACATAGAAATACAGG - Intronic
973734844 4:53861470-53861492 GTAATTAATTATGTAAATACAGG + Intronic
975025106 4:69538827-69538849 ATTTTTTATCATATAAATACTGG + Intergenic
975232944 4:71956143-71956165 GTATTTAAACAGGTAATTGCTGG - Intergenic
975354751 4:73388547-73388569 GTGTTTTAACATTTATATGCAGG + Intergenic
975436189 4:74354807-74354829 GGATTTTAACATCTAAACACAGG + Intergenic
975589895 4:75989551-75989573 GTATTTTAATATGTAAGAAGGGG - Intronic
976267207 4:83195536-83195558 GCCTTTTAACATGCAAATGCAGG - Intergenic
976690148 4:87860063-87860085 GTATTAATACATGTAATTACTGG - Intergenic
976839565 4:89415838-89415860 ATATTTTAACTTGCATATACAGG + Intergenic
977092229 4:92692042-92692064 TTCTTTTAACTTGTAAATACTGG + Intronic
977269979 4:94905872-94905894 GTATTTTAACATTTAAATAGTGG + Intronic
977441277 4:97070861-97070883 GGATTTTAACATATGAATGCAGG - Intergenic
978200745 4:106021317-106021339 ATAATTTAACATGTAAATACTGG - Intergenic
978298842 4:107242238-107242260 TGATTTTAAAAAGTAAATACTGG + Intronic
978639045 4:110846678-110846700 GTATTTAAACATGTAATAGCTGG - Intergenic
978945902 4:114495722-114495744 GTCTTTTAATATGCAAATGCAGG + Intergenic
979571436 4:122230911-122230933 GAATTTTAAACTGTATATACAGG - Intronic
979731189 4:124024431-124024453 AAATTTTAACATATAAATGCTGG - Intergenic
979882968 4:125986101-125986123 GTCTTTTAATATGCAAATGCAGG - Intergenic
980594549 4:134936217-134936239 GGATTTTAACATATGAATGCAGG - Intergenic
980603904 4:135064360-135064382 GGATTTTAACATGTGAATTTTGG - Intergenic
980623494 4:135341925-135341947 GTAGTTGAATATGTAAATACAGG + Intergenic
980990368 4:139734356-139734378 GTATTTTTAGTTGTAATTACTGG + Intronic
981179628 4:141725259-141725281 GTACTTCAACATATAAATCCAGG - Intronic
981365502 4:143897290-143897312 GTTATTTAATTTGTAAATACGGG - Intronic
981898884 4:149838147-149838169 TTATTTGAACAAGTAAATACAGG + Intergenic
981980349 4:150784494-150784516 GCCTTTTAATATGCAAATACAGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982352997 4:154436465-154436487 ATTTTTTAACATGAAAACACAGG - Intronic
982373791 4:154664013-154664035 GGATTTTGAAATGTTAATACAGG + Intronic
982510329 4:156274756-156274778 GAATTTCAACATGTAAATATGGG + Intergenic
982549268 4:156776908-156776930 GAATTTTTACATGTAAAAGCTGG - Intronic
983682473 4:170369814-170369836 GAATTGCAACATGTAAATATTGG + Intergenic
983711842 4:170726870-170726892 TTATTTTAATACCTAAATACTGG + Intergenic
983992044 4:174131252-174131274 GTAGTTTAACAAGAAAAGACTGG + Intergenic
984134448 4:175917675-175917697 GCATTTTAACATGTCCATCCTGG - Intronic
984204420 4:176768952-176768974 ATATTTTAACATGTGAATTTTGG - Intronic
984367801 4:178821113-178821135 GCCTTTTAATATGCAAATACAGG + Intergenic
984413239 4:179424237-179424259 GTTTTCTACCATGTAAATAGTGG - Intergenic
984638409 4:182139407-182139429 ATATGTTAACTTGTAAATATAGG - Intergenic
984819869 4:183872509-183872531 GTGTTTAAAAATGTAAATAAAGG + Intronic
984826946 4:183934001-183934023 CTATTTAAAGATGTAAATATTGG + Intronic
984941515 4:184936289-184936311 GTCTTTTAATATGCAAATGCAGG - Intergenic
985044285 4:185924612-185924634 GTCTTTTAATATGCAAATGCAGG - Intronic
987051879 5:14153821-14153843 GGATTTTAAAATGAAAATCCAGG - Intronic
987136827 5:14907490-14907512 TTAGTATTACATGTAAATACAGG + Intergenic
987204813 5:15614071-15614093 GGATTTCAACATGTGAATTCTGG + Intronic
987833930 5:23136507-23136529 ATATTTTAACATAGAAATATGGG + Intergenic
987912925 5:24171887-24171909 GTCATTTATCATTTAAATACCGG - Intronic
988016865 5:25570390-25570412 GCCTTTTAATATGCAAATACAGG - Intergenic
988106724 5:26760218-26760240 GGATTTTAACATATAAATTTTGG - Intergenic
988428337 5:31090196-31090218 GTGTTTTAACATGTAGATATAGG + Intergenic
988523344 5:31965390-31965412 GCCTTTTAATATGCAAATACAGG + Intronic
988631963 5:32941128-32941150 TTATTTTAACATGTGAGTGCTGG + Intergenic
989282012 5:39655216-39655238 GCATTTTAATATGCAAATGCAGG - Intergenic
991096951 5:62749841-62749863 GAATTTTAACATATAAATTTTGG - Intergenic
991244383 5:64493866-64493888 GTATTCTAGCATGTAAATTAAGG - Intergenic
991429916 5:66533726-66533748 CTATTTTAATATATAATTACAGG - Intergenic
993063064 5:83064163-83064185 ATATTTTAAAATGTAAAAATAGG + Intronic
993695343 5:91054771-91054793 GGATTTCAACATGTAAATTTTGG + Intronic
994309294 5:98248838-98248860 GTGTATTTACATATAAATACAGG + Intergenic
994369115 5:98948739-98948761 GTATTTGAACATATGAATATTGG + Intergenic
994717224 5:103336133-103336155 GTGTTTAAACATGTTATTACTGG + Intergenic
994924191 5:106092917-106092939 TTTTTTTAACATGTAAAAAAAGG + Intergenic
995419013 5:111941608-111941630 GGATTTTAACATATAAATTTTGG + Intronic
996223288 5:120959476-120959498 AGATTTAAACATGCAAATACAGG - Intergenic
996487103 5:124049375-124049397 ATCTTGTAACATGTATATACAGG - Intergenic
996645919 5:125816846-125816868 GGATTTTAACATATAAATTTTGG + Intergenic
996683610 5:126255879-126255901 GGATTTCAACACGTAAATTCTGG + Intergenic
997218967 5:132141961-132141983 GTATTTAAATATTTAAATATAGG + Intergenic
997218972 5:132142091-132142113 TTCTTTTAATATTTAAATACAGG + Intergenic
999910692 5:156195574-156195596 GTACATTAACATGTTAATAGTGG - Intronic
1000276588 5:159742056-159742078 GTCTTTTAATATGCAAATACAGG + Intergenic
1000790114 5:165595816-165595838 GTATTCTAACAAGAAAATTCTGG - Intergenic
1001275449 5:170347542-170347564 ATATATTAGCATTTAAATACAGG - Intergenic
1003198062 6:3932511-3932533 TTATTTTAACATATAAATTTTGG + Intergenic
1003663990 6:8092186-8092208 GAATTTTAACATATAAATTTGGG + Intronic
1003835895 6:10072324-10072346 GAATCTTTACATGTCAATACTGG - Intronic
1004271316 6:14198541-14198563 GTATTTTACCAGGTAAAGAATGG - Intergenic
1004821241 6:19370215-19370237 GTATTTTAAAATGTAAGCAATGG - Intergenic
1005256631 6:24010602-24010624 GAATTTTAAAATATAAAAACAGG + Intergenic
1005684459 6:28239440-28239462 GTTTTCAAACATGTAAATAGGGG - Intergenic
1005765381 6:29005977-29005999 GTATTTTTAAATGTAAATGATGG - Intergenic
1006383071 6:33712026-33712048 ATATATTTGCATGTAAATACAGG + Intergenic
1006529977 6:34643569-34643591 GAATTTAACCATGTAAATGCAGG - Intronic
1006658171 6:35614818-35614840 GGTTTTTAACATATACATACAGG + Intronic
1007058868 6:38917892-38917914 GTATTATAACCTGTAAGTTCTGG - Intronic
1008288592 6:49684686-49684708 AAATTTTAACATGTAAATTAGGG + Intergenic
1009529040 6:64786460-64786482 GTCTTTTAATATGCAAATGCAGG + Intronic
1010354384 6:74913973-74913995 GTATTTTAGCATCTAATTACCGG + Intergenic
1010355378 6:74926536-74926558 GTATTTTAAAATTTTAATAAGGG + Intergenic
1011032746 6:82941222-82941244 TTACTTTAAAATGTCAATACTGG + Intronic
1011580975 6:88864407-88864429 ATATGTTAACATGTAATTAATGG - Intronic
1011658607 6:89574901-89574923 TTTATTTAACATGTACATACAGG + Intronic
1011889872 6:92144796-92144818 TTATTTGAACATGAAAATAATGG - Intergenic
1012171313 6:96019948-96019970 TTATTTTAAGATGTTAATAAAGG + Intronic
1014164742 6:118210893-118210915 GGATTTTAACATATAAATTTGGG - Intronic
1014809009 6:125864517-125864539 GGATTTCAACATGTAAATTTGGG - Intronic
1015063034 6:128990900-128990922 TTCTTTTAACTTTTAAATACAGG - Intronic
1015518856 6:134112091-134112113 GGATTTAAACATGTGAATTCTGG + Intergenic
1015682045 6:135819082-135819104 GTATTTTAATATGGAAAAATGGG + Intergenic
1016100892 6:140098823-140098845 GTATTTTAACCTGTAGATACTGG + Intergenic
1016389214 6:143558313-143558335 ATATTTTTACATGTAAATAGGGG - Intronic
1016435582 6:144034143-144034165 GTGGTTTTACATGTAAACACAGG - Intronic
1016471568 6:144380340-144380362 GTATATAAACCTGTTAATACTGG + Intronic
1016565871 6:145453024-145453046 ATATTGTAACATGTAACTAAAGG + Intergenic
1016708677 6:147143816-147143838 GTATTTAAAAATGAAAATAAAGG - Intergenic
1016862487 6:148734778-148734800 GTATTTTAAAATGCAAAATCTGG + Intergenic
1017117423 6:150991600-150991622 GTAATTTGACATGTAGACACAGG + Intronic
1017428199 6:154343965-154343987 GTCTTTTAATATGCAAATGCAGG - Intronic
1018615441 6:165682433-165682455 GTATTTTAAGATATAAATTTGGG - Intronic
1019882677 7:3876549-3876571 TAATTTTAAAATGTAAAAACAGG + Intronic
1020691230 7:11356966-11356988 GGATCTTAATATGTAAATATAGG + Intergenic
1021177013 7:17460810-17460832 GTCTTTTAATATGTAAATGTGGG + Intergenic
1021279283 7:18697268-18697290 CCATTTTAAAATGTAAAAACAGG - Intronic
1021392015 7:20104334-20104356 GGTTTTCAACATGTAAATTCTGG - Intergenic
1021546267 7:21816268-21816290 GAATTCTGAGATGTAAATACTGG + Intronic
1021940747 7:25676802-25676824 CAATTAAAACATGTAAATACAGG - Intergenic
1021946494 7:25732900-25732922 GTCTTTTAACATGCAAATGTAGG + Intergenic
1022756024 7:33291359-33291381 GTATTTTAGCATTTAAAAATAGG - Intronic
1023773270 7:43579636-43579658 GAATTATGCCATGTAAATACAGG - Intergenic
1024634304 7:51274972-51274994 GTATTTTAATTTGTTAATATCGG - Intronic
1025236079 7:57235732-57235754 GTCTTTTAATATGCAAATACAGG + Intergenic
1026616987 7:71914055-71914077 GTTTTTTAACTTTTAAATTCCGG + Intronic
1027602273 7:80254133-80254155 GGATTTTAACATGTAAATTTGGG - Intergenic
1027828447 7:83147153-83147175 GTATATTAACACATAAATCCAGG + Intronic
1028586880 7:92460816-92460838 GAATTTTAACATGTCAACAGAGG + Intergenic
1029074741 7:97926859-97926881 GCATTTTAACATGGAGATTCTGG + Intergenic
1029250910 7:99235623-99235645 GTAATTTGATATGAAAATACCGG - Intergenic
1029273413 7:99390549-99390571 GTATTTTTAAATGTAGAGACGGG + Intronic
1029358784 7:100072937-100072959 ATATTTTAAAAAGTAAAGACAGG + Intronic
1030429707 7:109429225-109429247 CTATGTTAACATGTAAATAAAGG - Intergenic
1030516669 7:110547312-110547334 GTATTCTAATATGAAAATACTGG + Intergenic
1030719518 7:112853450-112853472 GTATTTTAATAAGGAAATATAGG + Intronic
1031300031 7:120053888-120053910 GTGGTTGAACATGTAAATAGGGG + Intergenic
1032296267 7:130641533-130641555 GTATTTAACCATGTTAAAACTGG + Intronic
1033475362 7:141687155-141687177 GTATTCTATCATGAAAATCCAGG - Intronic
1034736152 7:153431237-153431259 GTCTTTTAATATGCAAATACAGG - Intergenic
1035816200 8:2543733-2543755 GTATTTTTACTTTCAAATACTGG - Intergenic
1036021085 8:4847488-4847510 CTAATTTAACATGTTAATAGTGG - Intronic
1036174289 8:6522053-6522075 GGGTTTTAAAATGTAAATGCTGG + Intronic
1036242971 8:7094409-7094431 GCATTTTAACATGAAGATTCTGG - Intergenic
1036257829 8:7219638-7219660 GCATTTTAACATGGAGATTCTGG + Intergenic
1036259078 8:7226635-7226657 GCATTTTAACATGGAGATTCTGG + Intergenic
1036307544 8:7612876-7612898 GCATTTTAACATGGAGATTCTGG - Intergenic
1036309877 8:7678234-7678256 GCATTTTAACATGGAGATTCTGG + Intergenic
1036311131 8:7685231-7685253 GCATTTTAACATGGAGATTCTGG + Intergenic
1036358395 8:8060877-8060899 GCATTTTAACATGGAGATTCTGG - Intergenic
1036359655 8:8067885-8067907 GCATTTTAACATGGAGATTCTGG - Intergenic
1036724180 8:11204588-11204610 CTATATTAAAGTGTAAATACAGG - Intergenic
1036829761 8:12012755-12012777 GCATTTTAACATGAAGATTCTGG + Intergenic
1036891302 8:12599085-12599107 GCATTTTAACATGGAGATTCTGG + Intergenic
1036892559 8:12606075-12606097 GCATTTTAACATGGAGATTCTGG + Intergenic
1036898851 8:12657022-12657044 GCATTTTAACATGGAGATTCTGG + Intergenic
1036900107 8:12664054-12664076 GCATTTTAACATGAAGATTCTGG + Intergenic
1038076196 8:24077533-24077555 GAATTTTAACATTTAAAAACAGG + Intergenic
1038645409 8:29357359-29357381 AAATTTAAACATGTAAAAACTGG - Intergenic
1039118572 8:34120019-34120041 GCATTTTGACATGTAAATCTTGG + Intergenic
1039141260 8:34391150-34391172 GGATTTCAACATATGAATACTGG + Intergenic
1039192532 8:34993197-34993219 ATATTTGAACTTTTAAATACAGG - Intergenic
1039598724 8:38815138-38815160 GTATTTTAACATCTTTATCCTGG - Intronic
1040673294 8:49717942-49717964 GCCTTTTAATATGCAAATACAGG - Intergenic
1041044009 8:53874894-53874916 GAATTTTAATATGTAAATTTTGG + Intronic
1041882720 8:62770623-62770645 GGATTTTAACATATAAATTTGGG + Intronic
1041941204 8:63390087-63390109 TTATTTTAACATGTAAAACGAGG + Intergenic
1042996610 8:74706753-74706775 CTATTTATACATGTAAAAACTGG + Intronic
1043135939 8:76524850-76524872 ATAATTTCACATCTAAATACTGG + Intergenic
1043138533 8:76558416-76558438 AAATTTTAACATATAAATATTGG - Intergenic
1043145765 8:76651932-76651954 GTATTTCATCACGTAAGTACTGG - Intergenic
1043209128 8:77488844-77488866 CACTTTTCACATGTAAATACAGG + Intergenic
1044085233 8:87935546-87935568 GGATTTTAACATATAAATTTGGG + Intergenic
1044157770 8:88870993-88871015 GTAGTTTAAAATGAAAATAGAGG - Intergenic
1044980505 8:97711557-97711579 GTTTTTTAACATGTTACCACTGG - Intronic
1046050998 8:109022624-109022646 GTAATTTAACATGTTAACATGGG - Intergenic
1046061105 8:109140467-109140489 GTATCATAACACATAAATACAGG - Intergenic
1046426115 8:114052313-114052335 GTTATTTAACATATAAATAATGG + Intergenic
1046679845 8:117156351-117156373 GTACTTTAACATATAAATTTGGG + Intronic
1048784094 8:138032364-138032386 GTATTTTAAATTCTAAATATAGG - Intergenic
1050043903 9:1523792-1523814 GTACTTTAACATGTAAACTCAGG - Intergenic
1050050204 9:1592088-1592110 GTATTTTAACATGTAGACTTTGG - Intergenic
1050609305 9:7334974-7334996 TTAGTTCAACATGTAAATCCAGG + Intergenic
1050648329 9:7746486-7746508 GGATTTTAACATATAAATCCTGG - Intergenic
1051662658 9:19440354-19440376 GTATTTCAACATATGAATTCAGG - Intronic
1051809723 9:21034683-21034705 GAATTTTGACAGGTAAGTACTGG - Intergenic
1052140823 9:24980648-24980670 GTATTTTAAAATGAAAGTATTGG - Intergenic
1052481904 9:29040463-29040485 CTATTTTTACATATAAATACTGG + Intergenic
1052606604 9:30711398-30711420 GTAATTTAACATACAAATAAAGG - Intergenic
1054605007 9:67167004-67167026 GTATTTTAACATTTAACTAATGG + Intergenic
1055737390 9:79346343-79346365 GTATTTGTGTATGTAAATACAGG - Intergenic
1055923214 9:81483588-81483610 GATTTTTAAAAGGTAAATACAGG - Intergenic
1056076444 9:83046051-83046073 GTGTTTAAACATGAAAATATAGG - Intronic
1056720120 9:89064208-89064230 CTATTTTAACATATAAATTTGGG + Intronic
1058214059 9:102210961-102210983 GTCTATTAAAATGTAAACACTGG + Intergenic
1058253579 9:102732722-102732744 TTATTACATCATGTAAATACAGG + Intergenic
1059090024 9:111346532-111346554 GTATTTTTAAATGTAGAGACGGG - Intergenic
1059090170 9:111348194-111348216 GTATTTTTAAATGTAGAGACGGG + Intergenic
1059371320 9:113840690-113840712 GTATTTTAAAATTTAAAGACTGG + Intergenic
1060509183 9:124219689-124219711 GTATTTTCACATGTAAAAATGGG + Intergenic
1185918635 X:4063988-4064010 TTATTTAAACAAGTAAATTCAGG + Intergenic
1185956185 X:4493178-4493200 ATATTTTAATATTTAAATATAGG - Intergenic
1186015486 X:5187692-5187714 GTTTTATAAGATGTAAATATTGG + Intergenic
1186359489 X:8824895-8824917 TTATTTTAAAATGTAAATTCTGG - Intergenic
1188540477 X:31244743-31244765 ATCTTTTAAAATGTAAATAGTGG + Intronic
1188637686 X:32455408-32455430 GCATTTTCACATGTTAAGACAGG + Intronic
1188819648 X:34758990-34759012 GTATTCTAATATGTAATTAAGGG - Intergenic
1188936814 X:36185956-36185978 GGATTTTAACATATAAATTTGGG + Intergenic
1189312494 X:40029668-40029690 GGACTTCAACATGTGAATACTGG - Intergenic
1189587083 X:42473313-42473335 GTATTTTAACATGTATAGAATGG + Intergenic
1189590407 X:42505215-42505237 GCCTTTTAATATGCAAATACAGG + Intergenic
1189629133 X:42933456-42933478 GCATATTAAAATGTAAATGCTGG + Intergenic
1190884158 X:54516516-54516538 TGATTTTAGCATATAAATACTGG - Intergenic
1191204184 X:57816857-57816879 GTCTTTTAATATGCAAATGCTGG + Intergenic
1193469407 X:81880945-81880967 GGATTTCAACATGTAAATTTTGG - Intergenic
1194477343 X:94374891-94374913 GTAGTTAAGTATGTAAATACTGG + Intergenic
1194600670 X:95917511-95917533 GGAATTTAACATGTAAAAAGGGG + Intergenic
1195620640 X:106951098-106951120 ATATTTTTAAATGTTAATACTGG + Intronic
1196228580 X:113194493-113194515 GGATTTTAACATATAAATTGGGG - Intergenic
1196584582 X:117415153-117415175 GTTTTTTAACTTTTAAATTCAGG - Intergenic
1197145603 X:123168878-123168900 GTATATTCACATTTAAATAAGGG - Intergenic
1197394843 X:125914278-125914300 GTATTTAAAAATGTTATTACAGG + Intergenic
1197494931 X:127167258-127167280 GTTTTTTAAAATGAAAATAATGG + Intergenic
1197833884 X:130673997-130674019 ATACTTTAAAATGTAAATGCAGG + Intronic
1198633820 X:138673390-138673412 GTCTTTTAATATGGAAATGCAGG + Intronic
1199967147 X:152830297-152830319 GTTTTTTACAATTTAAATACAGG - Intronic
1200976825 Y:9220233-9220255 GTATTTGTACATGTGTATACAGG - Intergenic