ID: 1071692622

View in Genome Browser
Species Human (GRCh38)
Location 10:87838180-87838202
Sequence GAATGCATGAAACAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071692622_1071692625 17 Left 1071692622 10:87838180-87838202 CCAAGTAGCTGTTTCATGCATTC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1071692625 10:87838220-87838242 TATATTTAATGAAAAAGACAGGG No data
1071692622_1071692627 21 Left 1071692622 10:87838180-87838202 CCAAGTAGCTGTTTCATGCATTC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1071692627 10:87838224-87838246 TTTAATGAAAAAGACAGGGTGGG No data
1071692622_1071692629 26 Left 1071692622 10:87838180-87838202 CCAAGTAGCTGTTTCATGCATTC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1071692629 10:87838229-87838251 TGAAAAAGACAGGGTGGGCTGGG No data
1071692622_1071692624 16 Left 1071692622 10:87838180-87838202 CCAAGTAGCTGTTTCATGCATTC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1071692624 10:87838219-87838241 CTATATTTAATGAAAAAGACAGG No data
1071692622_1071692628 25 Left 1071692622 10:87838180-87838202 CCAAGTAGCTGTTTCATGCATTC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1071692628 10:87838228-87838250 ATGAAAAAGACAGGGTGGGCTGG No data
1071692622_1071692626 20 Left 1071692622 10:87838180-87838202 CCAAGTAGCTGTTTCATGCATTC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1071692626 10:87838223-87838245 ATTTAATGAAAAAGACAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071692622 Original CRISPR GAATGCATGAAACAGCTACT TGG (reversed) Intronic
900707095 1:4087621-4087643 GAATGGATGAATCAGCTCATGGG + Intergenic
901916232 1:12502677-12502699 GAGTGGCTGAAACAGTTACTTGG + Intronic
909252986 1:73381811-73381833 GAATGCAGAAAACATCAACTAGG + Intergenic
910031879 1:82736037-82736059 CAAGGCATGAAAAAGGTACTTGG - Intergenic
911628405 1:100153879-100153901 GCATGCCTATAACAGCTACTTGG - Intronic
911757302 1:101573768-101573790 GAATGAATGAACAAGCTAGTGGG - Intergenic
917847383 1:179032413-179032435 AAATGAATGAGCCAGCTACTCGG - Intronic
919778567 1:201209008-201209030 CAATGGATGAAACAGATAATAGG + Exonic
919995722 1:202747622-202747644 GAATCCATGAAAAAGCTACTGGG + Intronic
920003736 1:202817336-202817358 GAATACATGATAAAACTACTGGG + Intergenic
920452998 1:206074399-206074421 GAATGAATGTCAGAGCTACTTGG + Intronic
921061012 1:211584457-211584479 GAATGCATGAAATACCAAGTTGG - Intergenic
921816520 1:219569988-219570010 GCATGCCTGTAGCAGCTACTTGG + Intergenic
922806587 1:228393420-228393442 GAATGCAGGAAACATTTACCAGG + Intergenic
923145658 1:231195948-231195970 GAATGCATGAATCAGTGAATGGG - Intronic
1064196885 10:13250916-13250938 ACGTGCCTGAAACAGCTACTCGG + Intergenic
1065075217 10:22071868-22071890 GAATGCATGAAGTGGCCACTTGG - Intergenic
1065195313 10:23258488-23258510 GAATGCATCCAAAAGCTACCAGG + Intergenic
1071309883 10:84332865-84332887 GTATGCATCAAACAGGTACATGG - Intronic
1071692622 10:87838180-87838202 GAATGCATGAAACAGCTACTTGG - Intronic
1076065998 10:127448260-127448282 GAATGACTAAAACAGCTGCTGGG - Intronic
1079869447 11:25779195-25779217 GAATGCATGCCACAGCTATCTGG - Intergenic
1080934281 11:36845676-36845698 GAAAGGATGAAACAGTTCCTTGG + Intergenic
1081418023 11:42839112-42839134 GAATGCATACAACATATACTAGG + Intergenic
1082655667 11:55853893-55853915 GAATGTTTGAAATAGCTATTAGG - Intergenic
1082805336 11:57445650-57445672 TAATTTATGAAACAACTACTGGG - Intergenic
1084403485 11:68958168-68958190 GGATGCGGGAAACAGCTAGTGGG + Intergenic
1086296657 11:85375255-85375277 AAATGCATTAAATAACTACTGGG + Intronic
1086379550 11:86237687-86237709 GGATGCATGACTCAGCTACTCGG - Intergenic
1087728192 11:101747682-101747704 GAAAACATTAAAAAGCTACTTGG - Intronic
1087817952 11:102679622-102679644 GAATGCAAGAAAGAGCTAAGAGG + Intergenic
1087986245 11:104684301-104684323 GAATATATAAAACAACTACTTGG - Intergenic
1091560032 12:1605320-1605342 GAAGGCATGAAACAGGTATCAGG - Intronic
1097006830 12:55925886-55925908 TAATTCATGAAGGAGCTACTGGG + Intronic
1097181987 12:57177108-57177130 GATTGCAGGCAACATCTACTGGG + Exonic
1098251114 12:68570338-68570360 TCATGCCTGTAACAGCTACTCGG + Intergenic
1099594004 12:84634464-84634486 GAATGTCTCAAATAGCTACTAGG - Intergenic
1104209959 12:126679180-126679202 AAATGTATGAAACAGCTTCATGG + Intergenic
1104715408 12:131012954-131012976 AAATTCATGGAACAGATACTTGG + Intronic
1109135111 13:58639409-58639431 AATTACATGAAACTGCTACTTGG + Intergenic
1110969700 13:81745710-81745732 GGAAGCATGAAACACATACTTGG + Intergenic
1112170822 13:96970238-96970260 GAATTCATTTAACAGCCACTCGG - Intergenic
1112198973 13:97257045-97257067 GCATGCATGAAAAAGCAAATTGG - Intronic
1113272836 13:108693825-108693847 GAATCAAAAAAACAGCTACTAGG - Intronic
1114598222 14:23932628-23932650 GAAAACATGGAAAAGCTACTAGG + Intergenic
1115050579 14:29056728-29056750 CAATGGAGGAAAAAGCTACTGGG + Intergenic
1115712790 14:36069138-36069160 AAATGCATGAGTCACCTACTGGG + Intergenic
1115816014 14:37165414-37165436 GAAAGGATGAAACAGCAACCTGG + Intronic
1115976274 14:39000536-39000558 GAATAACTGAAACAGGTACTTGG + Intergenic
1118502423 14:66374176-66374198 GAGTGCATGTAACTGCTAGTTGG + Intergenic
1118649701 14:67877435-67877457 GAATGAATGAAAACACTACTTGG - Intronic
1119948061 14:78715442-78715464 GAATGAATAAAACAGCCAGTTGG - Intronic
1125398596 15:39276091-39276113 GATAGCATGAGAAAGCTACTAGG - Intergenic
1127001280 15:54509791-54509813 CAATTCATCAAACTGCTACTGGG - Intronic
1127936779 15:63648313-63648335 AAATGCATTAAAGAGCTATTTGG - Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1129066570 15:72909722-72909744 GAATGCTTGAAACACTTACTAGG - Intergenic
1129749962 15:78055750-78055772 GAATGGATGAAATGGCAACTTGG - Intronic
1131230802 15:90657769-90657791 GGATGCCTGAAACAGCTAATAGG + Intergenic
1132250254 15:100330652-100330674 GACTGCATGAAAGAGATCCTAGG + Intronic
1132286433 15:100666538-100666560 GTATGCATGATAAAACTACTAGG - Intergenic
1136184450 16:28578222-28578244 GAATCCATTAAACAACTATTAGG - Intronic
1136252079 16:29011884-29011906 GAATCCCTGAATCAGCTTCTTGG - Intergenic
1137888953 16:52138024-52138046 GAGTGCATGAGACAGCTACCTGG + Intergenic
1141208141 16:81950244-81950266 GAATGGATGGAAGAGTTACTGGG + Intronic
1144164197 17:12591908-12591930 GAAAGCATGAATCAGTTATTGGG + Intergenic
1148401405 17:47364927-47364949 GAACACATGCAACAGCTATTTGG - Intronic
1151373480 17:73665928-73665950 GGATTTATGAAACACCTACTAGG - Intergenic
1156122896 18:33866001-33866023 TAATGCCTTAAACAGTTACTTGG - Intronic
1158992946 18:62888923-62888945 GAATGAGTGAAACACATACTTGG - Intronic
1159098062 18:63927741-63927763 GAATGCAAGAAACATATATTAGG - Intronic
1168379799 19:55910408-55910430 GTATTTATGAAACTGCTACTTGG - Intronic
925447972 2:3943787-3943809 GAAAGCATGAAAGACCTCCTGGG + Intergenic
925888267 2:8412009-8412031 GAATGAATGAACCTGCCACTTGG + Intergenic
934058640 2:88273882-88273904 GAATGCATGGAAGAGTTCCTAGG + Intergenic
935415979 2:102819739-102819761 GAATGCCTGAGACAGATATTTGG - Intronic
939462135 2:142510932-142510954 GAAAGCATGAAAGAGCCAGTGGG + Intergenic
943721316 2:191206222-191206244 GAATGCAGCAACCAACTACTGGG - Intergenic
945224690 2:207521548-207521570 TTATGCATGAAACAGCAACAGGG + Intergenic
945424263 2:209680579-209680601 AAATGCATGAATCAGGTAATGGG + Intronic
945583303 2:211624685-211624707 CAAGGCATCAAACAACTACTGGG + Intronic
945966124 2:216188951-216188973 GAAGGGATGAAACGGTTACTGGG + Intronic
1174182508 20:48683689-48683711 GAACGCATCTAACAGCTTCTCGG + Intronic
1174292078 20:49516401-49516423 GCATGCTTGTATCAGCTACTTGG - Intronic
1174434978 20:50499824-50499846 GAAAGCATGAAGCAGCTATATGG - Intergenic
1178128675 21:29544976-29544998 GAATGCCTGAGACAGAGACTGGG - Intronic
1183981421 22:41542687-41542709 GAATGAATGAAACAGAGACAAGG - Intronic
949230186 3:1741759-1741781 GAAGCCAAGAATCAGCTACTAGG - Intergenic
949353426 3:3150635-3150657 GAATACCAGAAACATCTACTTGG - Exonic
951019993 3:17772795-17772817 AAATGAATAAAAGAGCTACTTGG - Intronic
951062078 3:18220909-18220931 TGATCCATGAAACAGCAACTTGG - Intronic
951769006 3:26233893-26233915 GCATGCATGTCCCAGCTACTGGG - Intergenic
952447153 3:33392244-33392266 GAATCCATGAAACTCCTATTGGG - Intronic
952990619 3:38828003-38828025 GAAGGCAGGAAAGAGCTAGTGGG + Intergenic
957571794 3:81956446-81956468 GTATGCATAACACAGGTACTAGG - Intergenic
957903252 3:86524818-86524840 GAATCCATGAATTAACTACTGGG + Intergenic
958545511 3:95543777-95543799 GAATGCATAAAGAAGCTGCTAGG - Intergenic
959314095 3:104779968-104779990 GAATGTATGAAAAAGCTATAGGG - Intergenic
959618711 3:108377042-108377064 AAAACCATGAAACAGCTAGTAGG + Intronic
960697000 3:120406117-120406139 GTGTGCATGAAACAACTATTAGG + Intronic
964026890 3:152084971-152084993 TATTGCTTGAAACAGCTGCTGGG - Intergenic
966976261 3:185086071-185086093 GAAGGCATGAATCAACTACGAGG - Intronic
970106677 4:12593758-12593780 AAAGTCATGAAACAGCTAATTGG + Intergenic
970564045 4:17314068-17314090 GAGTGCATGAAGTAGCTATTTGG - Intergenic
971133325 4:23837873-23837895 CCATGCATGAAACAGGTACAAGG - Intronic
975163468 4:71150276-71150298 GAATGGGTGAAATAGCAACTGGG + Intergenic
975442356 4:74426100-74426122 GAATGCATGAAAATGCTACATGG + Intergenic
976952838 4:90854352-90854374 ATTTGCATGAAACACCTACTTGG - Intronic
983989895 4:174105803-174105825 GAATGTAAGCAACAGATACTTGG + Intergenic
988968705 5:36444871-36444893 GAATGAATAAATGAGCTACTTGG - Intergenic
992290452 5:75274075-75274097 TAATGTATCAAAAAGCTACTTGG - Intergenic
994443790 5:99845428-99845450 AAATAAATGAAACAGCTGCTTGG + Intergenic
997775028 5:136596158-136596180 GAATGCATGCAGCCACTACTGGG - Intergenic
999169552 5:149581676-149581698 GGGTGCAGGAAACAGCTGCTGGG + Intronic
1006012680 6:31055671-31055693 AAAAGCATGAGACAGCTTCTGGG - Intergenic
1007780663 6:44252361-44252383 GAAGGCATGAAACAGTAAATAGG - Intronic
1008756415 6:54799776-54799798 AAATGCCTGAAATAGCTACATGG + Intergenic
1010203900 6:73306579-73306601 GAGGGCATGAAATAGCTCCTTGG - Intronic
1012831827 6:104213395-104213417 GAATGCATGAAACAGATGTGAGG - Intergenic
1013635467 6:112025261-112025283 GAAGGACTGAAACAGCTAATGGG - Intergenic
1013717762 6:112983886-112983908 TAAGGAATGAATCAGCTACTTGG + Intergenic
1014605702 6:123471712-123471734 GAATGCATGAAATATGTATTTGG - Intronic
1015810974 6:137162102-137162124 GAGTGAATGAAACAACTAGTGGG + Intronic
1016674012 6:146742123-146742145 GACAGCATGAAAGAGCTATTAGG - Intronic
1017255347 6:152327162-152327184 ACATGCCTGTAACAGCTACTTGG + Intronic
1017668624 6:156747651-156747673 GAATAAATAAAACAGCTATTGGG - Intergenic
1018663777 6:166114425-166114447 GTCTCCATGAAACAGCTCCTTGG + Intergenic
1026633494 7:72059901-72059923 GAACGCATGGAACAGCTATTTGG + Intronic
1026921431 7:74158437-74158459 TAATGGATGAGACAGCAACTTGG - Intergenic
1028824102 7:95249413-95249435 GAATGCTTGAAATAGCTCCTTGG - Intronic
1030079931 7:105768570-105768592 ACATGCATGAAACATGTACTTGG + Intronic
1031926269 7:127641812-127641834 AAATGCATGAAACAAAGACTTGG + Intergenic
1033070309 7:138195986-138196008 GAACGCCTGTACCAGCTACTTGG - Intergenic
1033275590 7:139969495-139969517 GTATTCATGAAAAAGCTAGTTGG - Intronic
1036445482 8:8818361-8818383 GGATGCATGAACCAGGAACTAGG - Intronic
1038391913 8:27209753-27209775 AGATGCATGGAACAGCTATTGGG - Intergenic
1041157101 8:54998944-54998966 AAATGCATGAAACTACTATTTGG + Intergenic
1043822085 8:84879217-84879239 AAATTGATGAAATAGCTACTGGG + Intronic
1044863979 8:96551410-96551432 GAATGCTTGGAATAGGTACTTGG - Intronic
1048719120 8:137302286-137302308 TAATACATGAAACAGCTGCTTGG + Intergenic
1050208224 9:3221682-3221704 GAATGGATGAACCATCTCCTTGG - Exonic
1050317877 9:4421869-4421891 GAATGCATGGATCAGCTTCAGGG + Intergenic
1051972668 9:22909672-22909694 GTAAGCATGGAAGAGCTACTAGG - Intergenic
1052512167 9:29435642-29435664 GAAAGCATGGAGCAGCTACATGG - Intergenic
1054763519 9:69024018-69024040 GAATGGATGTAACAGCAAATAGG + Intergenic
1056692037 9:88816017-88816039 GAACTCATGAAACATCTCCTGGG + Intergenic
1059389659 9:113991002-113991024 GAAGGGCAGAAACAGCTACTGGG - Intronic
1062030272 9:134359017-134359039 GCATTCATGGAACAGCTGCTGGG + Intronic
1185731732 X:2467091-2467113 GACTACATGTAACAGCTACTGGG + Intronic
1189646969 X:43143513-43143535 GAATGAATGAATAAGATACTAGG + Intergenic
1192798437 X:74443756-74443778 GAGTGCATGATACAGCTAGGAGG + Intronic
1194375711 X:93131181-93131203 GAATGGATCAAAAACCTACTTGG - Intergenic
1201684879 Y:16690015-16690037 GCATGCATGTGACAGCTACTTGG + Intergenic
1201868250 Y:18678094-18678116 GAATACATGACAGAGTTACTGGG - Intergenic