ID: 1071692697

View in Genome Browser
Species Human (GRCh38)
Location 10:87838830-87838852
Sequence ATCAGCTGGCACCTTGATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071692693_1071692697 -7 Left 1071692693 10:87838814-87838836 CCTCACCAGGAGTTAAATCAGCT No data
Right 1071692697 10:87838830-87838852 ATCAGCTGGCACCTTGATTCGGG No data
1071692691_1071692697 6 Left 1071692691 10:87838801-87838823 CCAGAAAGAGAGGCCTCACCAGG 0: 1
1: 21
2: 196
3: 763
4: 1728
Right 1071692697 10:87838830-87838852 ATCAGCTGGCACCTTGATTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071692697 Original CRISPR ATCAGCTGGCACCTTGATTC GGG Intronic
No off target data available for this crispr