ID: 1071692789

View in Genome Browser
Species Human (GRCh38)
Location 10:87839954-87839976
Sequence GTCTCTGGCCACCACTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071692789_1071692793 6 Left 1071692789 10:87839954-87839976 CCCTGCCAGTGGTGGCCAGAGAC 0: 1
1: 0
2: 3
3: 22
4: 181
Right 1071692793 10:87839983-87840005 TAACTCTGTTTGAGTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071692789 Original CRISPR GTCTCTGGCCACCACTGGCA GGG (reversed) Intronic
900799979 1:4731481-4731503 GTCTCTGGGGACCACTAGAAAGG - Intronic
900802909 1:4748366-4748388 GTCTCCGGCCAGCACCTGCAAGG + Intronic
900829147 1:4951821-4951843 GTCTCTGGCCAGCAGCGTCAAGG + Intergenic
900884160 1:5403654-5403676 GTCTCTGGGCAACACTGGGCTGG - Intergenic
901391526 1:8949300-8949322 GTCTCTGGCCCCCACAGGCGGGG - Exonic
902275177 1:15334480-15334502 GACTCTGGGTACCACTGCCAAGG + Intronic
902332620 1:15738050-15738072 GTCACTGGCCACCCCTGCCTAGG - Intronic
904532707 1:31180035-31180057 TCCTCTGGCCCCCACAGGCATGG - Exonic
904606263 1:31699584-31699606 GTCTCTGGCCAGCAGTGGGTGGG - Intronic
909225376 1:73013984-73014006 ACCTCTGGCAACCACTGTCAGGG + Intergenic
913082711 1:115403621-115403643 TTCTTGGGCCACCACTGGCATGG + Intergenic
913088014 1:115456963-115456985 ATCTCTTGCCACGACTGGCTGGG + Intergenic
913430762 1:118788683-118788705 GTCTGTGGGCCCCACTGCCATGG + Intergenic
924946306 1:248849219-248849241 GTGACTGGCCACCTCTGCCAGGG - Exonic
1064196442 10:13247569-13247591 GTCCCTGGCCTCCTTTGGCACGG - Intergenic
1064563137 10:16612375-16612397 GTCTTTGGCAATGACTGGCATGG - Intronic
1066649121 10:37638966-37638988 GTCTCTCCACACCACTGCCATGG - Intergenic
1067031975 10:42884379-42884401 GTCTCTCCACACCACTGCCATGG - Intergenic
1070327640 10:75398991-75399013 GTCTCTGGCCAGCGCTGCCGCGG - Exonic
1071692789 10:87839954-87839976 GTCTCTGGCCACCACTGGCAGGG - Intronic
1072098297 10:92204502-92204524 CTCCCTGGCCATCACTGGAAAGG + Intronic
1075345578 10:121679683-121679705 CTGTGTGGCCACCTCTGGCACGG + Intergenic
1076345214 10:129774743-129774765 GCCTCTGGCCACTGCTGGTATGG - Intergenic
1076848469 10:133081567-133081589 GTCTCTGTCCACCCCTCCCAGGG - Intronic
1077370886 11:2181126-2181148 CTCCCTGGCCGCCCCTGGCAGGG - Intergenic
1079311580 11:19371312-19371334 GACTCTGGCCTCCAATGGTAAGG - Intronic
1082813223 11:57491421-57491443 CTCTCTGGCCTCCGCTGGAAGGG - Intronic
1084456579 11:69271236-69271258 ATCTCTGGACCCCACTGGCTGGG - Intergenic
1084783914 11:71430548-71430570 GTGGCTGCCCTCCACTGGCAAGG + Intronic
1086822488 11:91451263-91451285 GTCTCTGACCAACACTGGGGAGG + Intergenic
1089594510 11:119568764-119568786 GTGTCTGGCCACATCTGCCATGG - Intergenic
1089816972 11:121184490-121184512 CTCTCTGACCACCACAGGGATGG - Intronic
1091184611 11:133636614-133636636 GTCTCTGGGCATCACTGGCAGGG - Intergenic
1091700751 12:2659957-2659979 GTTTCTGGCAGCCACTGGCTGGG - Intronic
1091962743 12:4712313-4712335 ATCTATGGGCACAACTGGCAGGG + Intronic
1092598905 12:10037416-10037438 GTCTCTGGCCACCTGAGACACGG - Intronic
1093110693 12:15148440-15148462 GTAGCTGACCAGCACTGGCATGG - Intronic
1094302370 12:28979170-28979192 GACTCTGGCCACAGGTGGCAAGG - Intergenic
1096000550 12:48126219-48126241 GACTCTGGCCAGGACTGGCTTGG + Intronic
1096414667 12:51402825-51402847 GTCTTTGCCCATCACTGGCAAGG - Intronic
1100179530 12:92070440-92070462 CTCTCACGCCACCTCTGGCAAGG + Intronic
1103747229 12:123133486-123133508 GTCACTTCCCACCACAGGCAGGG + Intronic
1103960086 12:124603948-124603970 GCCTCTGGCCAAGACTGGGATGG - Intergenic
1106428591 13:29657874-29657896 GTCTCTGGCCAGCACCAGCCTGG - Intergenic
1108272439 13:48774732-48774754 GTCTCTCCCCACCACAGCCAGGG + Intergenic
1108501167 13:51071338-51071360 GTCTCTGGCCTGCACTGGGTGGG - Intergenic
1109185380 13:59261723-59261745 GCCACTAGCCACCAGTGGCATGG + Intergenic
1111183065 13:84694117-84694139 CTGTCTGCCCAGCACTGGCAGGG - Intergenic
1117339536 14:54781653-54781675 GTCTGTGGCCACGAGGGGCAGGG + Intronic
1121050686 14:90817011-90817033 GTCTCCGTCCACCTCTGGCTGGG - Intergenic
1122782069 14:104147890-104147912 AGCTCTGGCACCCACTGGCAGGG - Intronic
1123037467 14:105477322-105477344 GCCCCTGGCTGCCACTGGCATGG - Intronic
1127098311 15:55535538-55535560 TTCTCTGTGCACCACAGGCAGGG - Intergenic
1127495296 15:59505641-59505663 GTGTCTGCCCACCACTGACAGGG + Intronic
1128468169 15:67929934-67929956 GTCTTTGACCTCCACTGGCTGGG + Intergenic
1129039198 15:72671010-72671032 GGCTCTGGCCACTAGGGGCAGGG - Intergenic
1132026812 15:98410900-98410922 ATCACTGTCCAGCACTGGCATGG - Intergenic
1132944276 16:2523930-2523952 ATCTCTGGCCAGCACAGGCGTGG + Intronic
1133294598 16:4745205-4745227 CTCTCTGGCCATAAATGGCAGGG + Intronic
1134683286 16:16141514-16141536 GTCTCAGGGCACCAGGGGCAGGG - Exonic
1135189535 16:20343809-20343831 GACTCTGTCCCCCACTGGCCAGG + Intronic
1136027094 16:27475503-27475525 GGCCCTGGGCAGCACTGGCAGGG + Intronic
1137900627 16:52264103-52264125 GTCTGTTGCCATCACTGGAAGGG - Intergenic
1138510138 16:57503961-57503983 GGAACTGGCCACCAGTGGCAAGG + Intergenic
1139439862 16:66960993-66961015 GTCACTGGCCACCACTTCCTAGG + Intergenic
1141558847 16:84853643-84853665 GTCTTTGGCCAGCACTGGCAGGG + Intronic
1141576124 16:84964440-84964462 CTCCCTGGTCACCCCTGGCAGGG - Intergenic
1141613673 16:85198153-85198175 AGCCCTGGCCACCACTGGGAGGG + Intergenic
1141669582 16:85484863-85484885 GTCTTTGGCCTCCACTGTGATGG + Intergenic
1141733984 16:85840229-85840251 GTCTCTGGCCTCCCCTCTCAGGG + Intergenic
1142034991 16:87857128-87857150 CTCTCTGGCCAGCAGTGGCAGGG - Intronic
1142223837 16:88867875-88867897 GTCTCCCACCACCAATGGCAGGG - Intergenic
1142264068 16:89055520-89055542 GTCACGGGGCACCACTGGCAGGG + Intergenic
1143778938 17:9219358-9219380 GACTGTGGCCACCAGTGCCATGG + Intronic
1144468410 17:15515654-15515676 GTCTCTGAACACCACAGCCAAGG + Intronic
1145930057 17:28678937-28678959 GGCTCTGGACACCACTGACATGG + Exonic
1146055102 17:29577046-29577068 CTCTCAGGTCACCACTGGCAGGG + Intronic
1146227531 17:31079786-31079808 GTCACTGGAAACCACTGGGAAGG + Intergenic
1146797477 17:35793275-35793297 ATCTGGGGCCACCACAGGCATGG + Intronic
1147662733 17:42125679-42125701 GACTCGGGCCACCACTGGGGGGG - Exonic
1149571944 17:57678329-57678351 GGCTCTGGCCAGCAATGGCTGGG - Intronic
1150755777 17:67911469-67911491 GTTCCTGGCCTCTACTGGCAAGG - Exonic
1151347475 17:73510975-73510997 GTCTTAGGCCACCTCTGGCCAGG + Intronic
1151652542 17:75479015-75479037 GTACCTGGGCACCAATGGCAGGG - Intronic
1152282729 17:79395026-79395048 AGCTGTGGCCACCACTGGGATGG - Intronic
1152939576 17:83161146-83161168 CACTCTGGCCAGCACTGGCTTGG - Intergenic
1155854342 18:30814067-30814089 CTCTCTGGTCACCACTAGCAAGG - Intergenic
1156467998 18:37360223-37360245 ATCTCTGGCCACCACCACCATGG + Intronic
1158337698 18:56431972-56431994 CTCTCTGTCCACCAATGGAAAGG + Intergenic
1160229281 18:77034254-77034276 GACTCCTGCCACCACTAGCAAGG + Intronic
1160903857 19:1442923-1442945 GTCTCTGGGCAGCACTGGCCAGG + Intergenic
1160905250 19:1448991-1449013 GTCCCGGGCCAGCACTGCCAGGG - Intronic
1161449837 19:4338868-4338890 GCCTCTGCCCAGCCCTGGCAGGG - Intronic
1162398189 19:10430176-10430198 CTCTCAGAGCACCACTGGCAGGG + Intronic
1162475397 19:10896529-10896551 GGCTCTGGGCAGCACTGGGAGGG - Intronic
1163290803 19:16377870-16377892 GGCTCTGACCACCTCTGGCCCGG + Intronic
1164127570 19:22332429-22332451 ACCTCTAGCCACCACTGGGATGG - Intergenic
1164772064 19:30816865-30816887 GTCACTGGCCACAAGTGACAAGG - Intergenic
1164807123 19:31125641-31125663 GTCTCTAGCCACCAAGTGCATGG - Intergenic
1166386808 19:42387081-42387103 TTCTCTGGCCACTCCTGGGAGGG - Exonic
1168615390 19:57833311-57833333 CTCTGTGGCCACCACCAGCACGG + Intronic
1168621394 19:57882136-57882158 CTCTGTGGCCACCACCAGCACGG - Intronic
1168645667 19:58057534-58057556 GTCTCTTGTAACCACTGGCTGGG - Intergenic
1168655108 19:58121808-58121830 CTCTCTGGCCACAACTGGTCAGG + Intergenic
925312301 2:2893759-2893781 GTCCCTGCCCACCAATGGCATGG - Intergenic
925359823 2:3270000-3270022 GTCTCTGACAACAACTGGTAAGG + Intronic
926075361 2:9938354-9938376 GGCTCTGGGCACCACTGGAGGGG + Intergenic
926957335 2:18315973-18315995 ATCTCTGCCCACCACAAGCATGG + Intronic
927267181 2:21163420-21163442 GACACTGGCCACCACTGCTATGG - Intergenic
927480337 2:23448787-23448809 TTCTCTGGCAAGCACAGGCAAGG - Intronic
932822006 2:74909432-74909454 GTCACTGGCCACTCCTCGCATGG - Intergenic
937040975 2:118820386-118820408 CTCTCTGCCCACCAGTGGCAGGG - Intergenic
938935626 2:136125188-136125210 GTCTCTGGACACTCCTGGGATGG + Intergenic
946509039 2:220334722-220334744 CTCTGTGGCCACCACTGCCCTGG + Intergenic
947329458 2:229013460-229013482 GTGTCTGCCAACCACTGGCTTGG - Intronic
948632208 2:239309611-239309633 CTCGCTGGCCCTCACTGGCAGGG - Intronic
1170972986 20:21133927-21133949 GTTTCTGACCCCCACTGGTAAGG + Intronic
1171008679 20:21493695-21493717 GTCTGTGGCCACCTTTGGCATGG + Intergenic
1171089540 20:22270886-22270908 GTTTCTGGGCACCACTTCCATGG - Intergenic
1171111664 20:22489847-22489869 GTCTCTAGCCCCAAATGGCAGGG - Intergenic
1172645529 20:36466808-36466830 GTCTCTGTACATCACTGGCCTGG + Intronic
1173399574 20:42712289-42712311 TTCTCAGGCCACAACTGGCTTGG + Intronic
1175744380 20:61445160-61445182 GACCCTGGCCACCTCTGGCCAGG + Intronic
1175771956 20:61629659-61629681 GGCTCTGGCCACCTCTGTTAAGG - Intronic
1175988490 20:62776190-62776212 GTCTCCATCCACGACTGGCAGGG + Intergenic
1177826179 21:26086035-26086057 GTCTCTGACCAGCAAAGGCAAGG - Intronic
1178936839 21:36870183-36870205 GCCTCTGGCCACCAGTGACCTGG + Intronic
1179244876 21:39624269-39624291 TTCCCTGGCCACCACTTTCAAGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1180082177 21:45491944-45491966 CTCTGTGGCCACCAGTGGAAGGG + Intronic
1180707835 22:17820106-17820128 GTCTCTTGCCCAGACTGGCATGG - Intronic
1180984074 22:19893755-19893777 GCCTCTGCCCAGCACTGGAAGGG + Intronic
1181316917 22:21976556-21976578 GTCTCCCAACACCACTGGCAGGG + Intronic
1181734980 22:24874490-24874512 CCCTCTGGCCACCACCAGCATGG - Exonic
1183591272 22:38780610-38780632 GCCTCTGTTCACCACTGGGATGG + Intronic
1183645374 22:39123343-39123365 GTCCCTGCCCACCACAGACAGGG - Intronic
1184238225 22:43197912-43197934 GTCTCTGGACTCCACCGCCAGGG + Exonic
1184677293 22:46050671-46050693 GTCTCTGACCACGGCTGGGAAGG + Exonic
949617205 3:5767044-5767066 GCTTCTGGCCAACTCTGGCAAGG + Intergenic
949895436 3:8764700-8764722 GACTCTGGCCACCACCAGCCTGG - Intronic
952107747 3:30088853-30088875 GAGTCTGGCCACCCCTGGCAAGG + Intergenic
954072333 3:48151978-48152000 TGCTCTGGCCAGCACTGGAAGGG + Intergenic
954136632 3:48584944-48584966 GCCTCTGGCCTCCATTTGCAGGG - Exonic
955329456 3:58034948-58034970 ATCTCAGCCCACCACTGGCAAGG + Intronic
957462838 3:80544497-80544519 ATCTCTGGACTCCACTGGCTGGG - Intergenic
958430749 3:94037923-94037945 GTCTCAGACCACAACTGGCATGG - Intronic
959574960 3:107924803-107924825 TTCTCTGGCCCCCCCTTGCAGGG + Intergenic
962457031 3:135573997-135574019 GGCTCTTGCCACCACATGCAGGG + Intergenic
964432825 3:156623827-156623849 GCCTTTGGCCACCCCTGGCAAGG + Intergenic
967995675 3:195164567-195164589 GTATCTGGCCACCTCTGGCCTGG - Intronic
969387599 4:6865638-6865660 CTCTCTGGCCACAGGTGGCATGG - Intronic
969694749 4:8728273-8728295 GTCTCAATCCAGCACTGGCAGGG - Intergenic
973698805 4:53516803-53516825 GTCTCTTACCCCCACGGGCATGG - Intronic
976992850 4:91390065-91390087 GTCCCTTTCCACCACTGGAAAGG - Intronic
979497727 4:121402975-121402997 GCCTCTAGCCACCAATGACATGG - Intergenic
980257605 4:130402567-130402589 CTCTCTGTGCACCACAGGCAGGG + Intergenic
982224643 4:153154305-153154327 GTGTCTGGCCTCCACGGTCAGGG + Intronic
986163345 5:5250957-5250979 CTCTCTGTCCACCACTGCTATGG - Intronic
986257065 5:6109400-6109422 GTTTGTGCCCACCACTGGCATGG + Intergenic
994242769 5:97444198-97444220 GTCTCTGGCCACCCCTTGCTGGG - Intergenic
995042187 5:107601388-107601410 GTCTCTGCCCACCACTGTACTGG + Intronic
995395596 5:111683210-111683232 GTCTATGGCCAGCTCTGCCATGG - Intronic
996177162 5:120373049-120373071 GTCTCTGACCACTGCTGGGAAGG - Intergenic
997329873 5:133052249-133052271 GTCTATGCCCACCACCGACATGG - Exonic
998107484 5:139477586-139477608 GGCTCTGGCCCCCAGTGCCACGG + Intronic
1002691028 5:181050732-181050754 GTCTGTATCCCCCACTGGCATGG - Intronic
1003021702 6:2515417-2515439 GGGTGTGGCCACCCCTGGCAAGG - Intergenic
1006922803 6:37637492-37637514 GGCTCTGGTCAGCTCTGGCAGGG + Intronic
1007207718 6:40166017-40166039 GTCTCTGAGCACTAATGGCAGGG + Intergenic
1007520718 6:42450575-42450597 GCCTCTGGCCAGCACTGGACTGG - Intronic
1007966760 6:46010475-46010497 ATCTCTTGCCACCACTAACATGG + Intronic
1012412053 6:98969686-98969708 GTCCTCGGCCACCACTGCCATGG - Intergenic
1017232857 6:152091661-152091683 GTCTTTGACCTCCATTGGCAAGG + Intronic
1018228745 6:161655419-161655441 GGCTCTCACCACCATTGGCACGG + Intronic
1019142340 6:169956819-169956841 GCCTCTGGGCACCACAGGGAAGG - Intergenic
1021640200 7:22729102-22729124 CTCTCTGGCTGCCCCTGGCAGGG + Intronic
1021960910 7:25872119-25872141 GCCTCTGGACACCACAGGAAAGG - Intergenic
1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG + Intergenic
1026220468 7:68392127-68392149 GGCTCCGGCCACCAGTGGCCTGG - Intergenic
1029683036 7:102125457-102125479 GTCCCTGGCCGCCGCTGGGAGGG + Intronic
1030089345 7:105843627-105843649 GCCACTGGCCACCACTGTGAGGG + Intronic
1039903953 8:41772836-41772858 GACTCTGGGCACCACTGATAAGG + Intronic
1040663289 8:49599853-49599875 GTCCCTGTCCAGCACTGTCAAGG + Intergenic
1046057777 8:109098810-109098832 TTTCCTGACCACCACTGGCAGGG + Intronic
1048138127 8:131766064-131766086 GTCCCTGGCCACAGCTGCCAAGG - Intergenic
1048283117 8:133120023-133120045 GTCTATGGCCACCCATGGCAAGG + Intronic
1049912349 9:281384-281406 GTCTTTGGTCTCCACTGGCTAGG + Intronic
1053509069 9:38671939-38671961 GTCTCTAGCCCCCACGGGGAGGG - Intergenic
1055127829 9:72739229-72739251 CTCTCTGGCCACTACTTACAAGG + Intronic
1056618114 9:88186020-88186042 CTCTCTGCCCACCACTGGACAGG - Intergenic
1056950055 9:91034598-91034620 GCGTCTGTCCAGCACTGGCAAGG - Intergenic
1057315979 9:93968752-93968774 CTGTCAGGCCACCTCTGGCAGGG - Intergenic
1059343844 9:113615289-113615311 GCCTCTAGCCACCTCTGGCCTGG + Intergenic
1059378791 9:113907470-113907492 TTCTCTTGCCACCCCGGGCAGGG + Intronic
1059678307 9:116561828-116561850 GTCTTTGTCCTCCACTGGCCTGG + Intronic
1059989278 9:119849487-119849509 GTATGTGGGCACCACTGTCATGG - Intergenic
1061083726 9:128387173-128387195 ACCTCTGGCCACCGCTGGCGCGG + Intronic
1062026209 9:134341928-134341950 GGCTCTGCCCACTACTGGCCTGG + Intronic
1062249858 9:135588612-135588634 GTCACTGGCCACCATGGCCATGG - Intergenic
1062730328 9:138104873-138104895 GTCTCTGGGCAGCACTGGCTGGG + Intronic
1187380308 X:18795506-18795528 GTCTCTGGCAGCTTCTGGCATGG + Intronic
1194556771 X:95369335-95369357 TTCTCTAGCCACCTCTGCCAAGG + Intergenic
1194917318 X:99722223-99722245 GTCTATGGGCACCACTTCCAAGG + Intergenic
1197562966 X:128047254-128047276 GTCTGTGGCCACCACTTGAGTGG - Intergenic
1197818588 X:130523845-130523867 GCCACTGGCCACCACTGGCAGGG - Intergenic
1200866821 Y:8052696-8052718 GGCTCTGGCCACAAGTGGGATGG + Intergenic
1200900227 Y:8424113-8424135 GGCTCTGGCCACAAGTGGGATGG - Intergenic