ID: 1071695927

View in Genome Browser
Species Human (GRCh38)
Location 10:87870974-87870996
Sequence GAAATCAGTACAGCCCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071695927_1071695934 30 Left 1071695927 10:87870974-87870996 CCCCCTTGGGCTGTACTGATTTC 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1071695934 10:87871027-87871049 AGCACTTGACTTCTAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071695927 Original CRISPR GAAATCAGTACAGCCCAAGG GGG (reversed) Intronic
901604788 1:10450542-10450564 GAAACCTGTGCAGCTCAAGGAGG + Intronic
902778904 1:18692140-18692162 GAGAGCTGGACAGCCCAAGGAGG + Intronic
902965186 1:19995921-19995943 GAAATCAGTCCATTCCAAGATGG + Intergenic
903917113 1:26772689-26772711 GAACTCCTTGCAGCCCAAGGTGG + Intronic
904279873 1:29411486-29411508 GAAATCAGCACAGCCTTTGGAGG + Intergenic
910359751 1:86403921-86403943 GAAATCAGCACATGCCATGGAGG - Intergenic
912427849 1:109610402-109610424 GAAGTCAGTACAGCCAGTGGAGG - Exonic
913033140 1:114932914-114932936 GAACCCACTACAGCTCAAGGAGG + Intronic
913167740 1:116204130-116204152 GCAATCTGTATAGCCCAAGAGGG + Intergenic
916123253 1:161547979-161548001 AGAATCACTACAACCCAAGGGGG + Intronic
916133147 1:161629337-161629359 AGAATCACTACAACCCAAGGGGG + Intronic
920269281 1:204751282-204751304 GAAATCAGGAGAGAACAAGGGGG - Intergenic
922018960 1:221684546-221684568 GAAATCAGTACTTCCAGAGGTGG + Intergenic
1066703963 10:38157437-38157459 GAAATGACGAAAGCCCAAGGGGG + Intergenic
1068864851 10:61884085-61884107 AGAATCACTTCAGCCCAAGGAGG - Intergenic
1069084259 10:64120786-64120808 GAGCCCAGCACAGCCCAAGGAGG + Intergenic
1070530244 10:77330704-77330726 AAAATCAGAACAGCCCAGGATGG + Intronic
1070711990 10:78689585-78689607 GAAATCTGTGCAGTCCCAGGAGG + Intergenic
1071695927 10:87870974-87870996 GAAATCAGTACAGCCCAAGGGGG - Intronic
1072457392 10:95588627-95588649 GAATTCAGTAATGCCAAAGGTGG - Intergenic
1073061873 10:100738133-100738155 GAACTCAGTGCAGGCCAGGGAGG - Intronic
1075333714 10:121594011-121594033 CAAATCACTCCAGCCCAAGTGGG + Intronic
1077981345 11:7303546-7303568 GAACTAAGTAGAGACCAAGGAGG - Intronic
1078626002 11:12958899-12958921 GAAATAATTACAGGCCGAGGAGG + Intergenic
1084599361 11:70135776-70135798 GGGATCATTACAGCCCAAGACGG - Intronic
1085000567 11:73029668-73029690 GAAGTCACTTCAGCCTAAGGGGG - Intronic
1088712809 11:112523826-112523848 TGAATCTGGACAGCCCAAGGTGG + Intergenic
1090647204 11:128775940-128775962 GAAGTCAGTAGAGTCCAAGTTGG + Intronic
1090932406 11:131310075-131310097 GACTTCAGTTCAGCCCAGGGTGG + Intergenic
1091598936 12:1905758-1905780 GATGTCAGTACTGCCCAAGGTGG + Intronic
1094856871 12:34406789-34406811 GCATGCAGTCCAGCCCAAGGTGG + Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1102999921 12:117377510-117377532 GACAACAGAACATCCCAAGGTGG + Intronic
1103732192 12:123035154-123035176 GACATCACTACATCCCAAGGGGG + Intronic
1104436568 12:128761685-128761707 GAAATGATTCCAGCCGAAGGGGG - Intergenic
1105357747 13:19674654-19674676 GAAAACAGTGGAGCTCAAGGAGG + Intergenic
1108715148 13:53071573-53071595 GACATAAGTAAAGCCCAAGGAGG + Intergenic
1111552479 13:89833049-89833071 GAAATCAGCACATTCCACGGAGG - Intergenic
1111949518 13:94699736-94699758 GAGATGACTACAGCCCCAGGTGG - Intergenic
1112587281 13:100730518-100730540 GAAATCAGGACATCCCAACAGGG + Intergenic
1117823411 14:59675017-59675039 GAAAACAATACAGCCCAGTGGGG + Intronic
1121403249 14:93701395-93701417 GAAATGAGTACAGTCCAACCAGG + Intronic
1121519636 14:94577178-94577200 GATAGCAGTACAGGCTAAGGGGG - Intronic
1122672998 14:103385968-103385990 CAAAACAGCACAGCCCTAGGAGG - Exonic
1124104134 15:26721524-26721546 GAAATGAGTACATCTCAAAGAGG - Intronic
1132750052 16:1453453-1453475 GAAATCAGCACAGACCAAGAAGG + Intronic
1134502137 16:14777587-14777609 GAAATCCGTACAGCCAGAGTCGG + Intronic
1134578423 16:15351306-15351328 GAAATCCGTACAGCCAGAGTCGG - Intergenic
1134724166 16:16406238-16406260 GAAATCCGTACAGCCAGAGTCGG + Intergenic
1134943264 16:18305631-18305653 GAAATCCGTACAGCCAGAGTCGG - Intergenic
1136480206 16:30536636-30536658 GAAATCAGCACATTCCATGGAGG - Intronic
1139495124 16:67311132-67311154 GAAAAGAGTACAGCCCAGTGAGG + Intronic
1141907621 16:87037927-87037949 GAAATCAGACCAGGCCCAGGAGG + Intergenic
1144016489 17:11201082-11201104 GAGATCAGTACACCCCATAGGGG - Intergenic
1146094953 17:29920534-29920556 GAATTTAGTACTTCCCAAGGAGG + Intronic
1154958146 18:21279796-21279818 TAAATCAGGACAGCCACAGGTGG - Intronic
1156269154 18:35515149-35515171 GACATCAGTGGAGCCCATGGAGG + Intergenic
1159145112 18:64444362-64444384 GAAATGAGTACATCTCAAAGAGG + Intergenic
1159558298 18:69967722-69967744 GAGATCAGTTCTGGCCAAGGAGG - Intergenic
1160876426 19:1298476-1298498 GAAGGGAGTACAGCCCCAGGAGG + Intronic
1163695314 19:18760781-18760803 GCAATCAGTGCAGCCACAGGAGG - Intronic
1163884304 19:19952308-19952330 TAAATCAGTACAGCCCCACCTGG - Intergenic
1163914801 19:20231711-20231733 TAAATCAGTACAGCCCCACTGGG - Intergenic
1164043613 19:21514097-21514119 TAAATCAGTACAGCCCCACCTGG + Intronic
1166803947 19:45473827-45473849 GAAATCAGAGCGGCCCAACGAGG - Exonic
928290641 2:30034363-30034385 GAAATCAAGACAGCCCAAGAAGG + Intergenic
929523809 2:42680839-42680861 AAAATCACTTCAGCCCAGGGAGG - Intronic
931048773 2:58387042-58387064 GAACCCAGCACAGCTCAAGGAGG - Intergenic
933809739 2:86025893-86025915 GAAATCAGTACCTCCTAACGGGG - Exonic
938777829 2:134557543-134557565 GAAAGCAGGACAACTCAAGGTGG + Intronic
940316821 2:152335528-152335550 GAAATCAGAACAGCTCCCGGCGG - Exonic
948352684 2:237353868-237353890 GGAGCCAGAACAGCCCAAGGAGG + Intronic
1168910938 20:1446136-1446158 GAAAGCAGGACAGCCTAGGGTGG + Intronic
1169408033 20:5341944-5341966 GATGTCAGTACTACCCAAGGTGG + Intergenic
1169444144 20:5657368-5657390 GAAATCCTTCCAGCCCGAGGAGG + Intergenic
1169689184 20:8311159-8311181 GAAATGAATACATCCCAAGTGGG - Intronic
1170927062 20:20734349-20734371 GCATTCAGTACAGCCAATGGCGG - Intergenic
1174502154 20:50993199-50993221 GAAAACAGTAGAGACCTAGGGGG - Intergenic
1176418796 21:6498248-6498270 GAAATTAGTACGTGCCAAGGTGG + Intergenic
1179694290 21:43106570-43106592 GAAATTAGTACGTGCCAAGGTGG + Intronic
1181001243 22:19988735-19988757 GAAACCTGGCCAGCCCAAGGAGG + Intronic
949527287 3:4917037-4917059 GAACCCACCACAGCCCAAGGAGG + Intergenic
955337278 3:58097166-58097188 GAATTCACTAAAGCCCAAGGTGG - Intronic
956657996 3:71570622-71570644 GCAATCATCTCAGCCCAAGGAGG + Intronic
959562933 3:107802979-107803001 CAAATCAATACATCCCAATGTGG - Intronic
961685302 3:128625772-128625794 CAAATGACTCCAGCCCAAGGAGG + Intronic
962039855 3:131695272-131695294 ACAATCAGTACAGCCAATGGTGG + Intronic
963444612 3:145388234-145388256 GAAGTCAATTCAGCCCAAGGAGG - Intergenic
964404377 3:156333220-156333242 GAACTCAGGACAGCCAAAAGGGG - Intronic
966678166 3:182611650-182611672 GAAATCAGCACATTCCATGGAGG + Intergenic
969854727 4:9990012-9990034 GAAAACAGAGCAGCTCAAGGAGG - Intronic
970052704 4:11933277-11933299 AAAATTAGTACAGTTCAAGGAGG + Intergenic
971357945 4:25911987-25912009 GAAGTCAGTACAGCAGAAGGAGG - Intronic
971414682 4:26413318-26413340 GAAATGGGGACGGCCCAAGGTGG - Intronic
973340514 4:48998765-48998787 GAAAGCAGCACAGCCACAGGAGG - Intronic
974142085 4:57900114-57900136 GAACCCACCACAGCCCAAGGAGG + Intergenic
977698115 4:99990174-99990196 GAAATCAGCACATTCCATGGAGG - Intergenic
977897901 4:102384623-102384645 GCAGTGGGTACAGCCCAAGGAGG - Intronic
978011150 4:103686534-103686556 GATAACAGTAAACCCCAAGGTGG + Intronic
978597943 4:110399200-110399222 GAAATCAGCACATTCCATGGAGG - Intronic
979180857 4:117725381-117725403 GAAAACAGTGCGGCCAAAGGTGG + Intergenic
992306631 5:75446906-75446928 GAAATCACTACAGCCAGAGGGGG + Intronic
994132934 5:96251214-96251236 GAAATCAGCCCAGCCGAAGCTGG - Intergenic
995956066 5:117778229-117778251 GAAATCAGCACATTCCATGGAGG - Intergenic
996106443 5:119509785-119509807 GAAATCAGCACATTCCATGGAGG - Intronic
998315248 5:141177372-141177394 GAAATCACAACAGCCCTATGTGG + Intergenic
999005304 5:147969832-147969854 GAAATAACTACAACCCAAGGTGG + Intergenic
1003866210 6:10365269-10365291 GAAATCAGCACATGCCATGGAGG - Intergenic
1007307961 6:40921852-40921874 GAAATCAACTCAGCACAAGGAGG + Intergenic
1009453630 6:63829581-63829603 GAAACCACTGCAGCTCAAGGAGG + Intronic
1010468710 6:76199795-76199817 GAAATCTGACCAGCCCAAGAGGG - Intergenic
1012962680 6:105638947-105638969 GGATTCAGAGCAGCCCAAGGTGG + Intergenic
1013296636 6:108763617-108763639 GAGAGCAGAACAACCCAAGGAGG - Intergenic
1013353423 6:109326578-109326600 GAAATCAGCACATTCCATGGAGG - Intergenic
1014840705 6:126217693-126217715 GAAACCAGCACAGCACTAGGTGG + Intergenic
1015576774 6:134680068-134680090 GAAATCACTAGTGCCCAAAGTGG + Intergenic
1015805299 6:137102347-137102369 GAAATGAGTAAAGCTGAAGGAGG - Intergenic
1015832433 6:137384995-137385017 GAAATCAGAAGAACCCAAGCTGG + Intergenic
1016187680 6:141218143-141218165 GAAATCACTTCAGCCAAAGTGGG - Intergenic
1019598305 7:1868643-1868665 GAAGTCAGCACAGCCCATGCCGG + Intronic
1024632125 7:51258437-51258459 GAAATCAGTACATTCCATGGAGG - Intronic
1028156826 7:87439534-87439556 GAAATCAATACAGCTCCATGAGG + Intronic
1029195268 7:98801508-98801530 GGAAGCAGCACAGCCCAAAGAGG + Intergenic
1035068501 7:156124565-156124587 GGACTCAGGACAGCACAAGGAGG - Intergenic
1036152981 8:6315686-6315708 GAAATGAGTCCATCCCCAGGGGG + Intergenic
1037396228 8:18446978-18447000 GGAATGAGAACAGCCCAAGAAGG + Intergenic
1037403523 8:18517793-18517815 GAAATGAGTAAATCCCAAAGTGG + Intergenic
1038051267 8:23814997-23815019 GAAAACACTTCAGCCCATGGAGG - Intergenic
1039476736 8:37842760-37842782 GAAATCAGTAGAGGGCAGGGAGG - Exonic
1040019123 8:42724637-42724659 GAAATCAGCACATTCCATGGAGG - Intronic
1040878752 8:52180801-52180823 GAAAGGAGTACAGAGCAAGGGGG + Intronic
1042093394 8:65184304-65184326 GAAATCAGGAAAGTCCAAGTGGG - Intergenic
1043587374 8:81784729-81784751 TAAATGAGTTCAGCCCAAGGTGG + Intergenic
1046825990 8:118692480-118692502 AAAATCAGTAAAGTCCCAGGTGG - Intergenic
1046936496 8:119889708-119889730 GAAAGCAGTGCAGGGCAAGGGGG + Intronic
1050261992 9:3850315-3850337 GAAATGAGCACAGTCCCAGGGGG - Intronic
1052267765 9:26594085-26594107 CAAATCAGTTCAACCCAAAGAGG - Intergenic
1055345130 9:75327462-75327484 GCAGTGGGTACAGCCCAAGGAGG - Intergenic
1056247783 9:84714349-84714371 AAAAGCAGTACAGCCCCAAGTGG - Intronic
1058515721 9:105772315-105772337 GAGGTCAATACAGCCCAAAGAGG - Intronic
1060418210 9:123447981-123448003 GAAATCTGTACGACCGAAGGGGG + Intronic
1062666167 9:137673917-137673939 GAGAACAGTACAGCCCTAGGAGG - Intronic
1190140602 X:47840359-47840381 GAAATCAGCACATTCCACGGAGG - Intronic
1191885416 X:65883039-65883061 GAAAGCAGTATAGTACAAGGGGG - Intergenic
1191885742 X:65886122-65886144 GACATCAGTACAGCCTGAGTTGG - Intergenic
1192683440 X:73278356-73278378 AACATCAGCACAGCCCAAGGTGG + Intergenic
1198753456 X:139958759-139958781 GCAATGGGTGCAGCCCAAGGAGG + Intronic
1199497208 X:148465668-148465690 GAAATCAGCACATTCCATGGGGG + Intergenic
1200987676 Y:9321118-9321140 GGAATCAGTTAAACCCAAGGAGG - Intergenic
1202333595 Y:23781163-23781185 GAAACCACCACAGCTCAAGGAGG - Intergenic
1202537174 Y:25888900-25888922 GAAACCACCACAGCTCAAGGAGG + Intergenic