ID: 1071697134

View in Genome Browser
Species Human (GRCh38)
Location 10:87888164-87888186
Sequence CCTAACCTGTGAAAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071697131_1071697134 2 Left 1071697131 10:87888139-87888161 CCTGGGAGAACTTCAGGCTTGAG 0: 1
1: 0
2: 3
3: 13
4: 180
Right 1071697134 10:87888164-87888186 CCTAACCTGTGAAAGCTGCATGG No data
1071697130_1071697134 6 Left 1071697130 10:87888135-87888157 CCAGCCTGGGAGAACTTCAGGCT 0: 1
1: 1
2: 5
3: 55
4: 278
Right 1071697134 10:87888164-87888186 CCTAACCTGTGAAAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071697134 Original CRISPR CCTAACCTGTGAAAGCTGCA TGG Intronic
No off target data available for this crispr